Incidental Mutation 'R6522:Snrnp200'
List |< first << previous [record 48 of 58] next >> last >|
ID521344
Institutional Source Beutler Lab
Gene Symbol Snrnp200
Ensembl Gene ENSMUSG00000003660
Gene Namesmall nuclear ribonucleoprotein 200 (U5)
SynonymsHELIC2, U5-200KD, A330064G03Rik, Ascc3l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6522 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location127208386-127240451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127221827 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 642 (T642I)
Ref Sequence ENSEMBL: ENSMUSP00000099509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103220]
Predicted Effect probably benign
Transcript: ENSMUST00000103220
AA Change: T642I

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099509
Gene: ENSMUSG00000003660
AA Change: T642I

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 206 223 N/A INTRINSIC
low complexity region 373 386 N/A INTRINSIC
DEXDc 477 690 2.63e-30 SMART
AAA 495 680 5.77e-2 SMART
HELICc 768 860 3.76e-17 SMART
low complexity region 876 887 N/A INTRINSIC
Sec63 981 1286 2.62e-128 SMART
DEXDc 1324 1528 1.43e-31 SMART
AAA 1342 1533 2.39e0 SMART
HELICc 1607 1695 1.26e-9 SMART
Sec63 1812 2124 1.39e-118 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142327
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: On February 19, 2002, this locus was switched from human to mouse. The source accession, Z70200.1, is almost identical to the mouse BAC clone AC074224, and it matches the mouse cDNA accession BC011390 as well. The human gene is LocusID 23020. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C A 10: 10,377,892 E1209* probably null Het
Adgrg5 G T 8: 94,942,068 R503L probably benign Het
Anks1b C T 10: 90,897,327 probably benign Het
Anxa5 A T 3: 36,465,302 F13I probably damaging Het
Bicd1 A G 6: 149,484,005 I79V probably benign Het
Bnip1 A G 17: 26,789,745 D107G probably damaging Het
Ccdc42 A G 11: 68,588,220 E78G probably damaging Het
Ccnk A G 12: 108,187,187 D69G probably damaging Het
Clec2i G T 6: 128,893,729 V77F probably damaging Het
Clec4g A C 8: 3,718,803 V62G probably benign Het
Col4a4 G A 1: 82,487,583 A957V unknown Het
Csnk1d A G 11: 120,971,623 F277L probably damaging Het
Dip2c G A 13: 9,575,228 probably null Het
Dpf2 T A 19: 5,905,532 K108* probably null Het
Dync1h1 G A 12: 110,616,737 D423N probably damaging Het
Fbxl13 T C 5: 21,561,556 probably null Homo
Flad1 T C 3: 89,403,183 R488G probably damaging Het
Galnt6 A C 15: 100,693,355 *623E probably null Het
Gtf2e1 T C 16: 37,511,454 T420A possibly damaging Het
Hspg2 T C 4: 137,555,275 V3442A probably damaging Het
Itpr1 A G 6: 108,388,276 D55G probably damaging Het
Kdm2a C A 19: 4,324,826 R759L possibly damaging Het
Kif19a A G 11: 114,785,779 E478G probably damaging Het
Lamb3 G A 1: 193,335,453 V881I probably benign Het
Map3k6 T C 4: 133,250,024 L894P possibly damaging Het
Mast4 A G 13: 102,761,293 probably null Het
Mst1r G A 9: 107,913,239 V684M probably benign Het
Naa15 T C 3: 51,471,514 S727P probably damaging Het
Nap1l1 T C 10: 111,494,223 L330S probably damaging Het
Nav2 A G 7: 49,597,533 T2205A probably damaging Het
Ncf2 T C 1: 152,827,463 probably null Het
Olfr1199 T C 2: 88,756,108 D189G probably damaging Het
Olfr503 G A 7: 108,544,995 V155I probably benign Het
Olfr622 T C 7: 103,639,297 Y281C probably damaging Het
Opa1 T A 16: 29,625,514 N839K probably benign Het
Pcdha7 T C 18: 36,973,942 Y7H possibly damaging Het
Pcdhb15 T C 18: 37,474,261 V182A probably benign Het
Phf10 A T 17: 14,956,007 I128N probably damaging Het
Plce1 T A 19: 38,748,521 probably null Het
Plxnb2 T C 15: 89,164,426 N626S probably benign Het
Prh1 G A 6: 132,572,033 G168R unknown Het
Prss51 A G 14: 64,097,406 T137A possibly damaging Het
Ptprcap C T 19: 4,156,184 R89C possibly damaging Het
Scfd1 A G 12: 51,431,541 K512R probably benign Het
Serpina1b A C 12: 103,735,037 probably null Het
Setbp1 T C 18: 78,857,390 T1021A probably damaging Het
Slco1b2 G A 6: 141,655,419 probably null Het
Tenm4 A C 7: 96,843,044 I1063L possibly damaging Het
Tfb2m G A 1: 179,546,046 A29V probably benign Het
Tfeb T C 17: 47,789,702 V140A probably damaging Het
Tmem104 A T 11: 115,243,753 I372F probably damaging Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Trim12c A T 7: 104,348,324 N8K probably benign Het
Tti2 A G 8: 31,153,603 I249V probably null Het
Vps8 T A 16: 21,442,379 L90I probably damaging Het
Vwf A T 6: 125,662,963 probably null Het
Wdfy4 A G 14: 33,146,944 S376P probably damaging Het
Other mutations in Snrnp200
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Snrnp200 APN 2 127230135 missense possibly damaging 0.80
IGL01013:Snrnp200 APN 2 127232472 missense probably damaging 1.00
IGL01073:Snrnp200 APN 2 127214912 splice site probably benign
IGL01319:Snrnp200 APN 2 127230127 splice site probably benign
IGL01597:Snrnp200 APN 2 127238732 unclassified probably benign
IGL01631:Snrnp200 APN 2 127238824 unclassified probably benign
IGL01646:Snrnp200 APN 2 127222228 missense probably benign 0.00
IGL02019:Snrnp200 APN 2 127232905 missense possibly damaging 0.94
IGL02158:Snrnp200 APN 2 127237483 missense probably benign 0.05
IGL02269:Snrnp200 APN 2 127229991 missense possibly damaging 0.67
IGL02288:Snrnp200 APN 2 127229895 missense probably damaging 1.00
IGL02437:Snrnp200 APN 2 127216110 missense probably damaging 1.00
IGL02476:Snrnp200 APN 2 127217488 missense probably benign 0.41
IGL02613:Snrnp200 APN 2 127218426 missense probably damaging 0.98
IGL02898:Snrnp200 APN 2 127216756 splice site probably benign
IGL03108:Snrnp200 APN 2 127238167 missense possibly damaging 0.82
IGL03143:Snrnp200 APN 2 127230042 critical splice donor site probably benign
IGL03237:Snrnp200 APN 2 127233313 missense probably damaging 0.99
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0057:Snrnp200 UTSW 2 127237907 missense probably damaging 0.96
R0270:Snrnp200 UTSW 2 127232982 missense probably damaging 0.97
R0626:Snrnp200 UTSW 2 127221814 missense possibly damaging 0.46
R0731:Snrnp200 UTSW 2 127226145 splice site probably benign
R1175:Snrnp200 UTSW 2 127229077 missense probably damaging 1.00
R1184:Snrnp200 UTSW 2 127236817 missense probably damaging 1.00
R1383:Snrnp200 UTSW 2 127218411 missense probably benign 0.10
R1444:Snrnp200 UTSW 2 127228238 splice site probably benign
R1757:Snrnp200 UTSW 2 127232443 missense probably damaging 1.00
R1794:Snrnp200 UTSW 2 127216736 missense probably benign
R1808:Snrnp200 UTSW 2 127219027 critical splice acceptor site probably null
R1808:Snrnp200 UTSW 2 127219028 critical splice acceptor site probably null
R1957:Snrnp200 UTSW 2 127216175 missense possibly damaging 0.69
R2007:Snrnp200 UTSW 2 127227048 missense probably damaging 1.00
R2039:Snrnp200 UTSW 2 127234984 missense probably benign 0.19
R2070:Snrnp200 UTSW 2 127212403 missense possibly damaging 0.89
R2070:Snrnp200 UTSW 2 127237883 missense probably benign 0.00
R2892:Snrnp200 UTSW 2 127231777 missense probably damaging 0.99
R3236:Snrnp200 UTSW 2 127221882 missense probably damaging 1.00
R3862:Snrnp200 UTSW 2 127233099 splice site probably benign
R4028:Snrnp200 UTSW 2 127237566 missense probably damaging 0.99
R4105:Snrnp200 UTSW 2 127228016 missense probably damaging 1.00
R4328:Snrnp200 UTSW 2 127222217 missense probably damaging 0.99
R4471:Snrnp200 UTSW 2 127238753 missense probably benign 0.03
R4526:Snrnp200 UTSW 2 127229102 missense probably benign
R4575:Snrnp200 UTSW 2 127235066 missense probably benign 0.00
R4710:Snrnp200 UTSW 2 127226133 missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127217414 missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127227878 missense possibly damaging 0.89
R4729:Snrnp200 UTSW 2 127232937 missense probably damaging 0.99
R4828:Snrnp200 UTSW 2 127211607 missense probably damaging 0.99
R5082:Snrnp200 UTSW 2 127226370 nonsense probably null
R5213:Snrnp200 UTSW 2 127231741 missense probably damaging 1.00
R5287:Snrnp200 UTSW 2 127231687 missense probably benign 0.13
R5486:Snrnp200 UTSW 2 127233066 missense possibly damaging 0.82
R5595:Snrnp200 UTSW 2 127226013 missense probably damaging 0.99
R5598:Snrnp200 UTSW 2 127226087 missense possibly damaging 0.64
R5681:Snrnp200 UTSW 2 127225135 missense probably damaging 1.00
R6207:Snrnp200 UTSW 2 127210735 missense probably benign 0.00
R6258:Snrnp200 UTSW 2 127218423 missense possibly damaging 0.60
R6259:Snrnp200 UTSW 2 127218423 missense possibly damaging 0.60
R6299:Snrnp200 UTSW 2 127222161 nonsense probably null
R6434:Snrnp200 UTSW 2 127238654 missense probably damaging 1.00
R6647:Snrnp200 UTSW 2 127226452 missense probably damaging 1.00
R6785:Snrnp200 UTSW 2 127229165 missense possibly damaging 0.70
R7027:Snrnp200 UTSW 2 127217272 missense probably benign 0.09
R7358:Snrnp200 UTSW 2 127221826 missense probably benign 0.03
R7436:Snrnp200 UTSW 2 127226484 critical splice donor site probably null
R7587:Snrnp200 UTSW 2 127227902 missense probably damaging 1.00
R7672:Snrnp200 UTSW 2 127221902 missense probably damaging 1.00
R7731:Snrnp200 UTSW 2 127229102 missense probably benign
R7841:Snrnp200 UTSW 2 127236834 missense probably benign 0.23
R7863:Snrnp200 UTSW 2 127231689 missense probably damaging 1.00
R8117:Snrnp200 UTSW 2 127229131 missense probably benign
R8262:Snrnp200 UTSW 2 127227008 missense probably damaging 1.00
RF016:Snrnp200 UTSW 2 127230556 missense probably damaging 1.00
Z1176:Snrnp200 UTSW 2 127234975 missense probably benign 0.10
Z1177:Snrnp200 UTSW 2 127236031 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGTTAAACAGTCCACACTCAG -3'
(R):5'- TATGCTCCTTAGAGAAGAGTAGGG -3'

Sequencing Primer
(F):5'- ACAGTCCACACTCAGTGTATATTTC -3'
(R):5'- CTCCTTAGAGAAGAGTAGGGAACAG -3'
Posted On2018-06-06