Incidental Mutation 'R6522:Clec2i'
List |< first << previous [record 9 of 58] next >> last >|
ID521362
Institutional Source Beutler Lab
Gene Symbol Clec2i
Ensembl Gene ENSMUSG00000030365
Gene NameC-type lectin domain family 2, member i
SynonymsClrg, Dcl1, Clr-g, OCILrP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6522 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location128887588-128898167 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 128893729 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 77 (V77F)
Ref Sequence ENSEMBL: ENSMUSP00000123804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032519] [ENSMUST00000159866] [ENSMUST00000160290] [ENSMUST00000160867] [ENSMUST00000162666] [ENSMUST00000178918]
PDB Structure
Mouse C-type lectin-related protein Clrg [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032519
AA Change: V73F

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032519
Gene: ENSMUSG00000030365
AA Change: V73F

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
CLECT 92 203 3.78e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159080
Predicted Effect probably damaging
Transcript: ENSMUST00000159866
AA Change: V77F

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123804
Gene: ENSMUSG00000030365
AA Change: V77F

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
CLECT 96 207 3.78e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160290
Predicted Effect probably benign
Transcript: ENSMUST00000160867
AA Change: V12F

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000145115
Gene: ENSMUSG00000030365
AA Change: V12F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CLECT 31 142 1.9e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162666
AA Change: V102F

PolyPhen 2 Score 0.420 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124910
Gene: ENSMUSG00000030365
AA Change: V102F

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
CLECT 121 232 3.78e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178918
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C A 10: 10,377,892 E1209* probably null Het
Adgrg5 G T 8: 94,942,068 R503L probably benign Het
Anks1b C T 10: 90,897,327 probably benign Het
Anxa5 A T 3: 36,465,302 F13I probably damaging Het
Bicd1 A G 6: 149,484,005 I79V probably benign Het
Bnip1 A G 17: 26,789,745 D107G probably damaging Het
Ccdc42 A G 11: 68,588,220 E78G probably damaging Het
Ccnk A G 12: 108,187,187 D69G probably damaging Het
Clec4g A C 8: 3,718,803 V62G probably benign Het
Col4a4 G A 1: 82,487,583 A957V unknown Het
Csnk1d A G 11: 120,971,623 F277L probably damaging Het
Dip2c G A 13: 9,575,228 probably null Het
Dpf2 T A 19: 5,905,532 K108* probably null Het
Dync1h1 G A 12: 110,616,737 D423N probably damaging Het
Fbxl13 T C 5: 21,561,556 probably null Homo
Flad1 T C 3: 89,403,183 R488G probably damaging Het
Galnt6 A C 15: 100,693,355 *623E probably null Het
Gtf2e1 T C 16: 37,511,454 T420A possibly damaging Het
Hspg2 T C 4: 137,555,275 V3442A probably damaging Het
Itpr1 A G 6: 108,388,276 D55G probably damaging Het
Kdm2a C A 19: 4,324,826 R759L possibly damaging Het
Kif19a A G 11: 114,785,779 E478G probably damaging Het
Lamb3 G A 1: 193,335,453 V881I probably benign Het
Map3k6 T C 4: 133,250,024 L894P possibly damaging Het
Mast4 A G 13: 102,761,293 probably null Het
Mst1r G A 9: 107,913,239 V684M probably benign Het
Naa15 T C 3: 51,471,514 S727P probably damaging Het
Nap1l1 T C 10: 111,494,223 L330S probably damaging Het
Nav2 A G 7: 49,597,533 T2205A probably damaging Het
Ncf2 T C 1: 152,827,463 probably null Het
Olfr1199 T C 2: 88,756,108 D189G probably damaging Het
Olfr503 G A 7: 108,544,995 V155I probably benign Het
Olfr622 T C 7: 103,639,297 Y281C probably damaging Het
Opa1 T A 16: 29,625,514 N839K probably benign Het
Pcdha7 T C 18: 36,973,942 Y7H possibly damaging Het
Pcdhb15 T C 18: 37,474,261 V182A probably benign Het
Phf10 A T 17: 14,956,007 I128N probably damaging Het
Plce1 T A 19: 38,748,521 probably null Het
Plxnb2 T C 15: 89,164,426 N626S probably benign Het
Prh1 G A 6: 132,572,033 G168R unknown Het
Prss51 A G 14: 64,097,406 T137A possibly damaging Het
Ptprcap C T 19: 4,156,184 R89C possibly damaging Het
Scfd1 A G 12: 51,431,541 K512R probably benign Het
Serpina1b A C 12: 103,735,037 probably null Het
Setbp1 T C 18: 78,857,390 T1021A probably damaging Het
Slco1b2 G A 6: 141,655,419 probably null Het
Snrnp200 C T 2: 127,221,827 T642I probably benign Het
Tenm4 A C 7: 96,843,044 I1063L possibly damaging Het
Tfb2m G A 1: 179,546,046 A29V probably benign Het
Tfeb T C 17: 47,789,702 V140A probably damaging Het
Tmem104 A T 11: 115,243,753 I372F probably damaging Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Trim12c A T 7: 104,348,324 N8K probably benign Het
Tti2 A G 8: 31,153,603 I249V probably null Het
Vps8 T A 16: 21,442,379 L90I probably damaging Het
Vwf A T 6: 125,662,963 probably null Het
Wdfy4 A G 14: 33,146,944 S376P probably damaging Het
Other mutations in Clec2i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02618:Clec2i APN 6 128896501 missense probably damaging 1.00
IGL03081:Clec2i APN 6 128894765 missense probably damaging 0.97
R0464:Clec2i UTSW 6 128895423 missense probably damaging 1.00
R0508:Clec2i UTSW 6 128893700 missense probably damaging 1.00
R1763:Clec2i UTSW 6 128895425 nonsense probably null
R1779:Clec2i UTSW 6 128888106 critical splice donor site probably null
R5020:Clec2i UTSW 6 128893658 missense probably benign 0.00
R6035:Clec2i UTSW 6 128893624 missense probably benign 0.01
R6035:Clec2i UTSW 6 128893624 missense probably benign 0.01
R6804:Clec2i UTSW 6 128895421 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTCTAAAAGGGTTGGCAGAAG -3'
(R):5'- TGCAACTTCCAGCTAGAACC -3'

Sequencing Primer
(F):5'- CTGATAGGCAATTGTAAAGCTTTGTG -3'
(R):5'- GATTTCTCCAGAGCCCTT -3'
Posted On2018-06-06