Mutagenetix > Incidental Mutations

Incidental Mutation 'R6522:Bicd1'

521368

Institutional Source

Beutler Lab

Gene Symbol

Bicd1

Ensembl Gene

ENSMUSG00000003452

Gene Name

BICD cargo adaptor 1

Synonyms

B830009D06Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6522 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

149408886-149563329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 149484005 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 79 (I79V)

Ref Sequence

ENSEMBL: ENSMUSP00000133727 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003544] [ENSMUST00000086829] [ENSMUST00000111513] [ENSMUST00000173408]

Predicted Effect

probably benign
Transcript: ENSMUST00000003544
AA Change: I79V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000003544
Gene: ENSMUSG00000003452
AA Change: I79V

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
Pfam:BicD	74	799	N/A	PFAM
low complexity region	807	820	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000086829
AA Change: I79V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000084039
Gene: ENSMUSG00000003452
AA Change: I79V

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
Pfam:BicD	74	799	N/A	PFAM
low complexity region	807	820	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111513
AA Change: I79V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000107138
Gene: ENSMUSG00000003452
AA Change: I79V

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
Pfam:BicD	74	799	N/A	PFAM
low complexity region	807	822	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130270

Predicted Effect

probably benign
Transcript: ENSMUST00000173408
AA Change: I79V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133727
Gene: ENSMUSG00000003452
AA Change: I79V

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
Pfam:BicD	74	799	N/A	PFAM
low complexity region	807	820	N/A	INTRINSIC

Meta Mutation Damage Score

0.0604

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.3%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D. It has been implicated in COPI-independent membrane transport from the Golgi apparatus to the endoplasmic reticulum. Two alternative splice variants have been described. Other alternative splice variants that encode different protein isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	C	A	10: 10,377,892	E1209*	probably null	Het
Adgrg5	G	T	8: 94,942,068	R503L	probably benign	Het
Anks1b	C	T	10: 90,897,327		probably benign	Het
Anxa5	A	T	3: 36,465,302	F13I	probably damaging	Het
Bnip1	A	G	17: 26,789,745	D107G	probably damaging	Het
Ccdc42	A	G	11: 68,588,220	E78G	probably damaging	Het
Ccnk	A	G	12: 108,187,187	D69G	probably damaging	Het
Clec2i	G	T	6: 128,893,729	V77F	probably damaging	Het
Clec4g	A	C	8: 3,718,803	V62G	probably benign	Het
Col4a4	G	A	1: 82,487,583	A957V	unknown	Het
Csnk1d	A	G	11: 120,971,623	F277L	probably damaging	Het
Dip2c	G	A	13: 9,575,228		probably null	Het
Dpf2	T	A	19: 5,905,532	K108*	probably null	Het
Dync1h1	G	A	12: 110,616,737	D423N	probably damaging	Het
Fbxl13	T	C	5: 21,561,556		probably null	Homo
Flad1	T	C	3: 89,403,183	R488G	probably damaging	Het
Galnt6	A	C	15: 100,693,355	*623E	probably null	Het
Gtf2e1	T	C	16: 37,511,454	T420A	possibly damaging	Het
Hspg2	T	C	4: 137,555,275	V3442A	probably damaging	Het
Itpr1	A	G	6: 108,388,276	D55G	probably damaging	Het
Kdm2a	C	A	19: 4,324,826	R759L	possibly damaging	Het
Kif19a	A	G	11: 114,785,779	E478G	probably damaging	Het
Lamb3	G	A	1: 193,335,453	V881I	probably benign	Het
Map3k6	T	C	4: 133,250,024	L894P	possibly damaging	Het
Mast4	A	G	13: 102,761,293		probably null	Het
Mst1r	G	A	9: 107,913,239	V684M	probably benign	Het
Naa15	T	C	3: 51,471,514	S727P	probably damaging	Het
Nap1l1	T	C	10: 111,494,223	L330S	probably damaging	Het
Nav2	A	G	7: 49,597,533	T2205A	probably damaging	Het
Ncf2	T	C	1: 152,827,463		probably null	Het
Olfr1199	T	C	2: 88,756,108	D189G	probably damaging	Het
Olfr503	G	A	7: 108,544,995	V155I	probably benign	Het
Olfr622	T	C	7: 103,639,297	Y281C	probably damaging	Het
Opa1	T	A	16: 29,625,514	N839K	probably benign	Het
Pcdha7	T	C	18: 36,973,942	Y7H	possibly damaging	Het
Pcdhb15	T	C	18: 37,474,261	V182A	probably benign	Het
Phf10	A	T	17: 14,956,007	I128N	probably damaging	Het
Plce1	T	A	19: 38,748,521		probably null	Het
Plxnb2	T	C	15: 89,164,426	N626S	probably benign	Het
Prh1	G	A	6: 132,572,033	G168R	unknown	Het
Prss51	A	G	14: 64,097,406	T137A	possibly damaging	Het
Ptprcap	C	T	19: 4,156,184	R89C	possibly damaging	Het
Scfd1	A	G	12: 51,431,541	K512R	probably benign	Het
Serpina1b	A	C	12: 103,735,037		probably null	Het
Setbp1	T	C	18: 78,857,390	T1021A	probably damaging	Het
Slco1b2	G	A	6: 141,655,419		probably null	Het
Snrnp200	C	T	2: 127,221,827	T642I	probably benign	Het
Tenm4	A	C	7: 96,843,044	I1063L	possibly damaging	Het
Tfb2m	G	A	1: 179,546,046	A29V	probably benign	Het
Tfeb	T	C	17: 47,789,702	V140A	probably damaging	Het
Tmem104	A	T	11: 115,243,753	I372F	probably damaging	Het
Tmem132d	G	T	5: 127,783,768	H1096Q	probably benign	Het
Trim12c	A	T	7: 104,348,324	N8K	probably benign	Het
Tti2	A	G	8: 31,153,603	I249V	probably null	Het
Vps8	T	A	16: 21,442,379	L90I	probably damaging	Het
Vwf	A	T	6: 125,662,963		probably null	Het
Wdfy4	A	G	14: 33,146,944	S376P	probably damaging	Het

Other mutations in Bicd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Bicd1	APN	6	149550390	missense	possibly damaging	0.72
IGL02489:Bicd1	APN	6	149513037	missense	probably damaging	1.00
IGL02626:Bicd1	APN	6	149409556	missense	probably damaging	1.00
IGL02966:Bicd1	APN	6	149483996	missense	probably damaging	0.99
IGL03256:Bicd1	APN	6	149513585	missense	probably benign
R0123:Bicd1	UTSW	6	149512950	missense	probably benign	0.00
R0131:Bicd1	UTSW	6	149512947	missense	probably damaging	0.99
R0134:Bicd1	UTSW	6	149512950	missense	probably benign	0.00
R0225:Bicd1	UTSW	6	149512950	missense	probably benign	0.00
R0267:Bicd1	UTSW	6	149517042	missense	probably damaging	1.00
R0481:Bicd1	UTSW	6	149511891	missense	possibly damaging	0.90
R0560:Bicd1	UTSW	6	149511962	missense	probably benign	0.34
R0729:Bicd1	UTSW	6	149512914	missense	probably damaging	0.97
R0784:Bicd1	UTSW	6	149513363	missense	probably damaging	0.98
R1994:Bicd1	UTSW	6	149513552	missense	probably benign	0.00
R2221:Bicd1	UTSW	6	149517005	missense	probably damaging	0.98
R2762:Bicd1	UTSW	6	149520403	missense	probably damaging	0.99
R3428:Bicd1	UTSW	6	149512902	missense	probably damaging	1.00
R3805:Bicd1	UTSW	6	149518991	missense	probably damaging	1.00
R3806:Bicd1	UTSW	6	149518991	missense	probably damaging	1.00
R3807:Bicd1	UTSW	6	149518991	missense	probably damaging	1.00
R4694:Bicd1	UTSW	6	149409553	missense	probably damaging	1.00
R4822:Bicd1	UTSW	6	149519254	intron	probably benign
R4835:Bicd1	UTSW	6	149484090	missense	probably benign	0.00
R5157:Bicd1	UTSW	6	149520414	missense	probably benign	0.09
R5527:Bicd1	UTSW	6	149494636	missense	probably damaging	1.00
R5611:Bicd1	UTSW	6	149513456	nonsense	probably null
R5643:Bicd1	UTSW	6	149520403	missense	probably damaging	0.99
R5644:Bicd1	UTSW	6	149520403	missense	probably damaging	0.99
R5788:Bicd1	UTSW	6	149484000	missense	probably benign	0.39
R5898:Bicd1	UTSW	6	149513703	missense	probably damaging	0.99
R6222:Bicd1	UTSW	6	149512965	missense	probably damaging	1.00
R6227:Bicd1	UTSW	6	149513176	nonsense	probably null
R6781:Bicd1	UTSW	6	149513166	missense	possibly damaging	0.86
R6812:Bicd1	UTSW	6	149409537	missense	probably damaging	1.00
R7010:Bicd1	UTSW	6	149494615	missense	probably damaging	1.00
R7203:Bicd1	UTSW	6	149512905	missense	possibly damaging	0.91
R7265:Bicd1	UTSW	6	149513876	missense	probably damaging	1.00
R7362:Bicd1	UTSW	6	149484093	missense	probably benign	0.13
R7526:Bicd1	UTSW	6	149513726	missense	possibly damaging	0.46
R7545:Bicd1	UTSW	6	149513492	missense	probably benign
R7581:Bicd1	UTSW	6	149519004	missense	probably damaging	1.00
R7589:Bicd1	UTSW	6	149513667	missense	possibly damaging	0.61
R7639:Bicd1	UTSW	6	149513004	missense	possibly damaging	0.92
R7715:Bicd1	UTSW	6	149512973	missense	probably benign	0.11
R8188:Bicd1	UTSW	6	149550356	missense	probably damaging	0.98
R8271:Bicd1	UTSW	6	149513135	missense	probably benign	0.00
R8338:Bicd1	UTSW	6	149513123	missense	probably benign	0.00
R8375:Bicd1	UTSW	6	149520491	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGGTTTCAATCCTCCCAGACTG -3'
(R):5'- GCCGAGAGCCTCTCATTTTC -3'

Sequencing Primer
(F):5'- CCAGACTGGGTATGAGTTATTACAC -3'
(R):5'- CTGCCTGGACATTTGTAACCACAG -3'

Posted On

2018-06-06