Incidental Mutation 'R6548:Plk5'
ID521379
Institutional Source Beutler Lab
Gene Symbol Plk5
Ensembl Gene ENSMUSG00000035486
Gene Namepolo like kinase 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6548 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80356459-80365489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80363045 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 412 (L412H)
Ref Sequence ENSEMBL: ENSMUSP00000100988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039836] [ENSMUST00000105351]
Predicted Effect probably damaging
Transcript: ENSMUST00000039836
AA Change: L416H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044400
Gene: ENSMUSG00000035486
AA Change: L416H

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
S_TKc 27 283 2.41e-90 SMART
Pfam:POLO_box 425 486 4.9e-18 PFAM
low complexity region 583 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105351
AA Change: L412H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100988
Gene: ENSMUSG00000035486
AA Change: L412H

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
S_TKc 27 279 2.56e-94 SMART
Pfam:POLO_box 420 483 1.6e-17 PFAM
low complexity region 579 592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152544
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 93% (38/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030612E09Rik T C 10: 43,174,773 L21P probably damaging Het
Ank3 C T 10: 69,892,410 A642V probably damaging Het
Bap1 A G 14: 31,256,225 N349S probably benign Het
Brca1 G T 11: 101,524,765 Q32K probably damaging Het
Ccdc39 A T 3: 33,837,959 N121K probably benign Het
Champ1 A T 8: 13,880,002 N720I probably damaging Het
Chd3 T A 11: 69,362,060 R216* probably null Het
D630003M21Rik A G 2: 158,205,699 probably null Het
Exoc2 A T 13: 30,826,064 V804E possibly damaging Het
Fcgbp A G 7: 28,091,918 N868S probably benign Het
Gm10376 T C 14: 43,015,568 M1V probably null Het
Gpc2 G A 5: 138,277,271 probably null Het
Gpr37 G A 6: 25,688,813 T95I probably benign Het
Ints3 G A 3: 90,392,124 probably benign Het
Krt28 T C 11: 99,367,013 E334G probably damaging Het
Lrrc75a T A 11: 62,606,095 T214S probably damaging Het
Lyar A G 5: 38,227,858 I81V probably benign Het
Mon2 A T 10: 123,036,093 L342Q probably damaging Het
Mug2 C T 6: 122,047,442 A491V probably damaging Het
Myh2 A G 11: 67,186,612 T858A probably benign Het
Net1 C T 13: 3,886,074 probably null Het
Olfr502 T C 7: 108,523,216 T245A probably benign Het
Olfr593 T A 7: 103,211,904 Y4N probably benign Het
Platr25 A T 13: 62,673,809 I110N possibly damaging Het
Rasal1 A T 5: 120,674,725 T605S probably benign Het
Ryr2 T A 13: 11,668,821 D3119V probably damaging Het
Serpina1a G T 12: 103,853,758 H387N probably benign Het
Serpina1d G T 12: 103,767,552 N164K probably damaging Het
Smurf1 A G 5: 144,899,497 Y69H probably damaging Het
Sod2 A G 17: 13,008,363 K68R probably benign Het
Ssbp2 A G 13: 91,539,351 N51S possibly damaging Het
Tcl1b1 A G 12: 105,164,404 R49G probably benign Het
Tgfb1 A G 7: 25,696,925 I214M probably benign Het
Tln1 A G 4: 43,547,525 I812T probably damaging Het
Topaz1 T A 9: 122,748,354 C110S possibly damaging Het
Ubap2l A G 3: 90,023,560 F393L probably damaging Het
Vmn1r62 G A 7: 5,675,770 G150D probably damaging Het
Wdr24 C A 17: 25,827,925 Q651K probably damaging Het
Wdr7 A G 18: 63,778,251 T905A possibly damaging Het
Zfyve26 A G 12: 79,238,335 F2382S probably damaging Het
Other mutations in Plk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Plk5 APN 10 80363167 critical splice donor site probably null
IGL02605:Plk5 APN 10 80363062 missense probably damaging 0.99
R0083:Plk5 UTSW 10 80356662 missense possibly damaging 0.91
R0590:Plk5 UTSW 10 80360223 missense probably damaging 1.00
R0783:Plk5 UTSW 10 80361130 missense probably benign
R1815:Plk5 UTSW 10 80364021 missense probably benign 0.03
R1866:Plk5 UTSW 10 80360569 splice site probably null
R1991:Plk5 UTSW 10 80363102 missense possibly damaging 0.53
R4501:Plk5 UTSW 10 80359471 missense probably benign 0.05
R4580:Plk5 UTSW 10 80360467 missense possibly damaging 0.95
R4731:Plk5 UTSW 10 80358797 missense probably damaging 1.00
R4801:Plk5 UTSW 10 80359304 missense possibly damaging 0.87
R4802:Plk5 UTSW 10 80359304 missense possibly damaging 0.87
R5084:Plk5 UTSW 10 80358889 missense possibly damaging 0.75
R5346:Plk5 UTSW 10 80363108 missense probably damaging 1.00
R5702:Plk5 UTSW 10 80360567 critical splice donor site probably null
R6417:Plk5 UTSW 10 80364072 missense probably benign 0.07
R6695:Plk5 UTSW 10 80360201 missense probably benign 0.22
X0019:Plk5 UTSW 10 80364301 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACACAGATACAGCACAGACAAAG -3'
(R):5'- TCAAGAGACGGGGTAAAGCA -3'

Sequencing Primer
(F):5'- GCACAGGCACAGACACAG -3'
(R):5'- TAAAGCATGGGTCCCTGGG -3'
Posted On2018-06-06