Incidental Mutation 'R6522:Adgrg5'
ID521384
Institutional Source Beutler Lab
Gene Symbol Adgrg5
Ensembl Gene ENSMUSG00000061577
Gene Nameadhesion G protein-coupled receptor G5
SynonymsGpr114, PGR27, LOC382045
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6522 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location94923694-94943280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 94942068 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 503 (R503L)
Ref Sequence ENSEMBL: ENSMUSP00000074155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074570] [ENSMUST00000128308] [ENSMUST00000166802]
Predicted Effect probably benign
Transcript: ENSMUST00000074570
AA Change: R503L

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074155
Gene: ENSMUSG00000061577
AA Change: R503L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 87 95 N/A INTRINSIC
GPS 181 234 4.7e-13 SMART
Pfam:7tm_2 240 494 2.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128308
SMART Domains Protein: ENSMUSP00000120217
Gene: ENSMUSG00000061577

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 83 91 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166802
AA Change: R504L

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132628
Gene: ENSMUSG00000061577
AA Change: R504L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 87 95 N/A INTRINSIC
GPS 181 234 1.37e-14 SMART
Pfam:7tm_2 241 495 1.3e-36 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adhesion family of G-protein coupled receptors. Members of this family are characterized by long N-termini and multiple functional domains. They may play a role in the immune system as well as in the central nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C A 10: 10,377,892 E1209* probably null Het
Anks1b C T 10: 90,897,327 probably benign Het
Anxa5 A T 3: 36,465,302 F13I probably damaging Het
Bicd1 A G 6: 149,484,005 I79V probably benign Het
Bnip1 A G 17: 26,789,745 D107G probably damaging Het
Ccdc42 A G 11: 68,588,220 E78G probably damaging Het
Ccnk A G 12: 108,187,187 D69G probably damaging Het
Clec2i G T 6: 128,893,729 V77F probably damaging Het
Clec4g A C 8: 3,718,803 V62G probably benign Het
Col4a4 G A 1: 82,487,583 A957V unknown Het
Csnk1d A G 11: 120,971,623 F277L probably damaging Het
Dip2c G A 13: 9,575,228 probably null Het
Dpf2 T A 19: 5,905,532 K108* probably null Het
Dync1h1 G A 12: 110,616,737 D423N probably damaging Het
Fbxl13 T C 5: 21,561,556 probably null Homo
Flad1 T C 3: 89,403,183 R488G probably damaging Het
Galnt6 A C 15: 100,693,355 *623E probably null Het
Gtf2e1 T C 16: 37,511,454 T420A possibly damaging Het
Hspg2 T C 4: 137,555,275 V3442A probably damaging Het
Itpr1 A G 6: 108,388,276 D55G probably damaging Het
Kdm2a C A 19: 4,324,826 R759L possibly damaging Het
Kif19a A G 11: 114,785,779 E478G probably damaging Het
Lamb3 G A 1: 193,335,453 V881I probably benign Het
Map3k6 T C 4: 133,250,024 L894P possibly damaging Het
Mast4 A G 13: 102,761,293 probably null Het
Mst1r G A 9: 107,913,239 V684M probably benign Het
Naa15 T C 3: 51,471,514 S727P probably damaging Het
Nap1l1 T C 10: 111,494,223 L330S probably damaging Het
Nav2 A G 7: 49,597,533 T2205A probably damaging Het
Ncf2 T C 1: 152,827,463 probably null Het
Olfr1199 T C 2: 88,756,108 D189G probably damaging Het
Olfr503 G A 7: 108,544,995 V155I probably benign Het
Olfr622 T C 7: 103,639,297 Y281C probably damaging Het
Opa1 T A 16: 29,625,514 N839K probably benign Het
Pcdha7 T C 18: 36,973,942 Y7H possibly damaging Het
Pcdhb15 T C 18: 37,474,261 V182A probably benign Het
Phf10 A T 17: 14,956,007 I128N probably damaging Het
Plce1 T A 19: 38,748,521 probably null Het
Plxnb2 T C 15: 89,164,426 N626S probably benign Het
Prh1 G A 6: 132,572,033 G168R unknown Het
Prss51 A G 14: 64,097,406 T137A possibly damaging Het
Ptprcap C T 19: 4,156,184 R89C possibly damaging Het
Scfd1 A G 12: 51,431,541 K512R probably benign Het
Serpina1b A C 12: 103,735,037 probably null Het
Setbp1 T C 18: 78,857,390 T1021A probably damaging Het
Slco1b2 G A 6: 141,655,419 probably null Het
Snrnp200 C T 2: 127,221,827 T642I probably benign Het
Tenm4 A C 7: 96,843,044 I1063L possibly damaging Het
Tfb2m G A 1: 179,546,046 A29V probably benign Het
Tfeb T C 17: 47,789,702 V140A probably damaging Het
Tmem104 A T 11: 115,243,753 I372F probably damaging Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Trim12c A T 7: 104,348,324 N8K probably benign Het
Tti2 A G 8: 31,153,603 I249V probably null Het
Vps8 T A 16: 21,442,379 L90I probably damaging Het
Vwf A T 6: 125,662,963 probably null Het
Wdfy4 A G 14: 33,146,944 S376P probably damaging Het
Other mutations in Adgrg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Adgrg5 APN 8 94937629 missense probably damaging 1.00
IGL02617:Adgrg5 APN 8 94933982 missense probably benign 0.01
R0483:Adgrg5 UTSW 8 94933508 missense possibly damaging 0.73
R0539:Adgrg5 UTSW 8 94938632 missense probably damaging 1.00
R0580:Adgrg5 UTSW 8 94937344 critical splice donor site probably null
R0650:Adgrg5 UTSW 8 94934157 critical splice donor site probably null
R0652:Adgrg5 UTSW 8 94934157 critical splice donor site probably null
R0828:Adgrg5 UTSW 8 94941785 splice site probably null
R1546:Adgrg5 UTSW 8 94941630 missense probably benign 0.27
R1567:Adgrg5 UTSW 8 94937698 missense probably damaging 0.97
R1695:Adgrg5 UTSW 8 94937745 missense probably damaging 1.00
R1753:Adgrg5 UTSW 8 94942052 missense possibly damaging 0.65
R1852:Adgrg5 UTSW 8 94937800 missense probably damaging 1.00
R2018:Adgrg5 UTSW 8 94934480 missense probably damaging 1.00
R2051:Adgrg5 UTSW 8 94942067 missense probably benign 0.01
R2190:Adgrg5 UTSW 8 94933951 missense probably damaging 1.00
R2299:Adgrg5 UTSW 8 94938576 missense possibly damaging 0.88
R2568:Adgrg5 UTSW 8 94934021 missense probably damaging 0.99
R4283:Adgrg5 UTSW 8 94937698 missense probably benign 0.21
R4512:Adgrg5 UTSW 8 94934024 missense possibly damaging 0.90
R4825:Adgrg5 UTSW 8 94941734 missense possibly damaging 0.77
R5422:Adgrg5 UTSW 8 94933952 missense probably damaging 1.00
R5427:Adgrg5 UTSW 8 94935102 missense probably benign 0.27
R6186:Adgrg5 UTSW 8 94934024 missense possibly damaging 0.90
R6608:Adgrg5 UTSW 8 94941720 missense probably damaging 1.00
R6810:Adgrg5 UTSW 8 94933942 missense probably damaging 0.97
R6816:Adgrg5 UTSW 8 94941683 missense probably damaging 0.99
R7214:Adgrg5 UTSW 8 94934018 missense
R7686:Adgrg5 UTSW 8 94937802 missense
X0027:Adgrg5 UTSW 8 94937338 missense probably benign 0.07
Z1176:Adgrg5 UTSW 8 94935151 missense
Predicted Primers PCR Primer
(F):5'- GCTGGTCTAGGGGCACATTTAC -3'
(R):5'- CCCAGGTAATTCGGAGAGATGG -3'

Sequencing Primer
(F):5'- TTACCTAGAAGAGAGGCTTGCCTC -3'
(R):5'- CCTGAAGGGTACAGTAGACTCTG -3'
Posted On2018-06-06