Incidental Mutation 'R6522:Adgb'
List [record 1 of 58] next >> last >|
ID521388
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Nameandroglobin
Synonyms9130014G24Rik
MMRRC Submission
Accession Numbers

MGI:3605549

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6522 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location10335703-10472326 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 10377892 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1209 (E1209*)
Ref Sequence ENSEMBL: ENSMUSP00000146658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
Predicted Effect probably benign
Transcript: ENSMUST00000148816
SMART Domains Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 1 41 1e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000172530
AA Change: E1233*
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: E1233*

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179956
AA Change: E1235*
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: E1235*

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000208717
AA Change: E1209*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 G T 8: 94,942,068 R503L probably benign Het
Anks1b C T 10: 90,897,327 probably benign Het
Anxa5 A T 3: 36,465,302 F13I probably damaging Het
Bicd1 A G 6: 149,484,005 I79V probably benign Het
Bnip1 A G 17: 26,789,745 D107G probably damaging Het
Ccdc42 A G 11: 68,588,220 E78G probably damaging Het
Ccnk A G 12: 108,187,187 D69G probably damaging Het
Clec2i G T 6: 128,893,729 V77F probably damaging Het
Clec4g A C 8: 3,718,803 V62G probably benign Het
Col4a4 G A 1: 82,487,583 A957V unknown Het
Csnk1d A G 11: 120,971,623 F277L probably damaging Het
Dip2c G A 13: 9,575,228 probably null Het
Dpf2 T A 19: 5,905,532 K108* probably null Het
Dync1h1 G A 12: 110,616,737 D423N probably damaging Het
Fbxl13 T C 5: 21,561,556 probably null Homo
Flad1 T C 3: 89,403,183 R488G probably damaging Het
Galnt6 A C 15: 100,693,355 *623E probably null Het
Gtf2e1 T C 16: 37,511,454 T420A possibly damaging Het
Hspg2 T C 4: 137,555,275 V3442A probably damaging Het
Itpr1 A G 6: 108,388,276 D55G probably damaging Het
Kdm2a C A 19: 4,324,826 R759L possibly damaging Het
Kif19a A G 11: 114,785,779 E478G probably damaging Het
Lamb3 G A 1: 193,335,453 V881I probably benign Het
Map3k6 T C 4: 133,250,024 L894P possibly damaging Het
Mast4 A G 13: 102,761,293 probably null Het
Mst1r G A 9: 107,913,239 V684M probably benign Het
Naa15 T C 3: 51,471,514 S727P probably damaging Het
Nap1l1 T C 10: 111,494,223 L330S probably damaging Het
Nav2 A G 7: 49,597,533 T2205A probably damaging Het
Ncf2 T C 1: 152,827,463 probably null Het
Olfr1199 T C 2: 88,756,108 D189G probably damaging Het
Olfr503 G A 7: 108,544,995 V155I probably benign Het
Olfr622 T C 7: 103,639,297 Y281C probably damaging Het
Opa1 T A 16: 29,625,514 N839K probably benign Het
Pcdha7 T C 18: 36,973,942 Y7H possibly damaging Het
Pcdhb15 T C 18: 37,474,261 V182A probably benign Het
Phf10 A T 17: 14,956,007 I128N probably damaging Het
Plce1 T A 19: 38,748,521 probably null Het
Plxnb2 T C 15: 89,164,426 N626S probably benign Het
Prh1 G A 6: 132,572,033 G168R unknown Het
Prss51 A G 14: 64,097,406 T137A possibly damaging Het
Ptprcap C T 19: 4,156,184 R89C possibly damaging Het
Scfd1 A G 12: 51,431,541 K512R probably benign Het
Serpina1b A C 12: 103,735,037 probably null Het
Setbp1 T C 18: 78,857,390 T1021A probably damaging Het
Slco1b2 G A 6: 141,655,419 probably null Het
Snrnp200 C T 2: 127,221,827 T642I probably benign Het
Tenm4 A C 7: 96,843,044 I1063L possibly damaging Het
Tfb2m G A 1: 179,546,046 A29V probably benign Het
Tfeb T C 17: 47,789,702 V140A probably damaging Het
Tmem104 A T 11: 115,243,753 I372F probably damaging Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Trim12c A T 7: 104,348,324 N8K probably benign Het
Tti2 A G 8: 31,153,603 I249V probably null Het
Vps8 T A 16: 21,442,379 L90I probably damaging Het
Vwf A T 6: 125,662,963 probably null Het
Wdfy4 A G 14: 33,146,944 S376P probably damaging Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10406099 missense possibly damaging 0.87
IGL01083:Adgb APN 10 10407554 missense possibly damaging 0.50
IGL03064:Adgb APN 10 10400572 missense probably benign 0.02
R0080:Adgb UTSW 10 10377839 splice site probably benign
R0084:Adgb UTSW 10 10396344 missense possibly damaging 0.74
R0112:Adgb UTSW 10 10407158 splice site probably benign
R0348:Adgb UTSW 10 10357879 missense probably benign
R0415:Adgb UTSW 10 10431067 splice site probably null
R0633:Adgb UTSW 10 10391729 missense probably benign 0.36
R1052:Adgb UTSW 10 10442613 missense probably benign 0.29
R1248:Adgb UTSW 10 10395310 missense probably damaging 0.98
R1278:Adgb UTSW 10 10382828 missense probably damaging 1.00
R1568:Adgb UTSW 10 10442665 nonsense probably null
R1647:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1648:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1663:Adgb UTSW 10 10339675 missense possibly damaging 0.86
R1688:Adgb UTSW 10 10350317 nonsense probably null
R1758:Adgb UTSW 10 10426605 missense probably damaging 1.00
R1772:Adgb UTSW 10 10382721 splice site probably benign
R1850:Adgb UTSW 10 10442502 missense probably damaging 1.00
R1959:Adgb UTSW 10 10395249 missense probably benign 0.02
R1980:Adgb UTSW 10 10433498 missense probably benign
R2179:Adgb UTSW 10 10395274 missense possibly damaging 0.94
R2229:Adgb UTSW 10 10436051 missense probably damaging 1.00
R2283:Adgb UTSW 10 10377891 missense probably damaging 0.99
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2875:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2876:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2920:Adgb UTSW 10 10390243 missense probably damaging 1.00
R2931:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R3722:Adgb UTSW 10 10340510 missense probably benign 0.32
R3846:Adgb UTSW 10 10382721 splice site probably benign
R3877:Adgb UTSW 10 10442483 critical splice donor site probably null
R4210:Adgb UTSW 10 10407465 missense probably benign 0.06
R4211:Adgb UTSW 10 10407465 missense probably benign 0.06
R4333:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R4448:Adgb UTSW 10 10390825 missense probably benign 0.32
R4470:Adgb UTSW 10 10398951 missense probably benign 0.02
R4624:Adgb UTSW 10 10403004 missense probably benign 0.00
R4656:Adgb UTSW 10 10405306 missense probably damaging 0.99
R4676:Adgb UTSW 10 10426710 missense probably damaging 1.00
R4792:Adgb UTSW 10 10398903 missense probably damaging 0.96
R4795:Adgb UTSW 10 10357872 missense probably benign 0.01
R4858:Adgb UTSW 10 10349577 missense probably damaging 1.00
R4985:Adgb UTSW 10 10400632 missense possibly damaging 0.69
R5057:Adgb UTSW 10 10357978 missense probably benign 0.11
R5157:Adgb UTSW 10 10398966 missense probably damaging 1.00
R5209:Adgb UTSW 10 10398937 missense possibly damaging 0.71
R5339:Adgb UTSW 10 10442606 missense probably damaging 1.00
R5376:Adgb UTSW 10 10346563 missense probably benign 0.09
R5426:Adgb UTSW 10 10350260 missense probably benign 0.14
R5516:Adgb UTSW 10 10431157 missense probably damaging 1.00
R5554:Adgb UTSW 10 10340473 missense probably damaging 0.98
R5678:Adgb UTSW 10 10431326 missense possibly damaging 0.83
R5707:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5708:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5891:Adgb UTSW 10 10377847 nonsense probably null
R5928:Adgb UTSW 10 10378787 missense probably damaging 1.00
R6005:Adgb UTSW 10 10395352 missense probably damaging 1.00
R6017:Adgb UTSW 10 10450036 missense probably damaging 1.00
R6049:Adgb UTSW 10 10378026 missense probably damaging 1.00
R6118:Adgb UTSW 10 10431291 missense probably damaging 1.00
R6175:Adgb UTSW 10 10398943 missense possibly damaging 0.94
R6186:Adgb UTSW 10 10422758 missense probably damaging 1.00
R6234:Adgb UTSW 10 10353080 intron probably null
R6383:Adgb UTSW 10 10450028 missense probably damaging 1.00
R6639:Adgb UTSW 10 10435956 missense possibly damaging 0.51
R6697:Adgb UTSW 10 10406126 nonsense probably null
R6742:Adgb UTSW 10 10411849 missense probably damaging 1.00
R6745:Adgb UTSW 10 10390197 missense probably damaging 1.00
R6850:Adgb UTSW 10 10394574 missense probably benign 0.39
R7128:Adgb UTSW 10 10472241 missense probably benign 0.26
R7326:Adgb UTSW 10 10400574 missense possibly damaging 0.80
R7386:Adgb UTSW 10 10377949 missense possibly damaging 0.52
R7431:Adgb UTSW 10 10391955 intron probably null
R7569:Adgb UTSW 10 10431252 missense probably benign
R7579:Adgb UTSW 10 10410818 nonsense probably null
R7582:Adgb UTSW 10 10390821 missense probably damaging 1.00
R7615:Adgb UTSW 10 10436010 missense probably damaging 0.96
R7692:Adgb UTSW 10 10411712 critical splice donor site probably null
R7774:Adgb UTSW 10 10339660 nonsense probably null
R7808:Adgb UTSW 10 10378659 splice site probably null
R8158:Adgb UTSW 10 10378734 missense probably benign 0.22
X0003:Adgb UTSW 10 10394630 missense possibly damaging 0.76
Z1176:Adgb UTSW 10 10378742 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGTGAATACAGGGCACTAGGG -3'
(R):5'- ACGAGATCCTGCTTTTATTCTTTAAG -3'

Sequencing Primer
(F):5'- CCAGAGTCAGCTTGGAGTTTC -3'
(R):5'- TGGGAACTGAACAAGGATCCTCTTC -3'
Posted On2018-06-06