Mutagenetix > Incidental Mutation

Incidental Mutation 'R6522:Nap1l1'

521392

Institutional Source

Beutler Lab

Gene Symbol

Nap1l1

Ensembl Gene

ENSMUSG00000058799

Gene Name

nucleosome assembly protein 1-like 1

Synonyms

D10Ertd68e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.318) question?

Stock #

R6522 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

111473223-111498150 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 111494223 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 330 (L330S)

Ref Sequence

ENSEMBL: ENSMUSP00000151972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065917] [ENSMUST00000171797] [ENSMUST00000217908] [ENSMUST00000218828] [ENSMUST00000219143] [ENSMUST00000219961]

AlphaFold

P28656

Predicted Effect

probably damaging
Transcript: ENSMUST00000065917
AA Change: L330S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000070068
Gene: ENSMUSG00000058799
AA Change: L330S

Domain	Start	End	E-Value	Type
coiled coil region	6	31	N/A	INTRINSIC
Pfam:NAP	75	346	1.5e-96	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000171797
AA Change: L357S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126850
Gene: ENSMUSG00000058799
AA Change: L357S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
coiled coil region	33	58	N/A	INTRINSIC
Pfam:NAP	103	372	9.6e-110	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000217908
AA Change: L330S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218828
AA Change: L330S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218982

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219143
AA Change: L330S

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219718

Predicted Effect

probably damaging
Transcript: ENSMUST00000219961
AA Change: L330S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.3%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleosome assembly protein (NAP) family. This protein participates in DNA replication and may play a role in modulating chromatin formation and contribute to the regulation of cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms; however, not all have been fully described. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	C	A	10: 10,377,892	E1209*	probably null	Het
Adgrg5	G	T	8: 94,942,068	R503L	probably benign	Het
Anks1b	C	T	10: 90,897,327		probably benign	Het
Anxa5	A	T	3: 36,465,302	F13I	probably damaging	Het
Bicd1	A	G	6: 149,484,005	I79V	probably benign	Het
Bnip1	A	G	17: 26,789,745	D107G	probably damaging	Het
Ccdc42	A	G	11: 68,588,220	E78G	probably damaging	Het
Ccnk	A	G	12: 108,187,187	D69G	probably damaging	Het
Clec2i	G	T	6: 128,893,729	V77F	probably damaging	Het
Clec4g	A	C	8: 3,718,803	V62G	probably benign	Het
Col4a4	G	A	1: 82,487,583	A957V	unknown	Het
Csnk1d	A	G	11: 120,971,623	F277L	probably damaging	Het
Dip2c	G	A	13: 9,575,228		probably null	Het
Dpf2	T	A	19: 5,905,532	K108*	probably null	Het
Dync1h1	G	A	12: 110,616,737	D423N	probably damaging	Het
Fbxl13	T	C	5: 21,561,556		probably null	Homo
Flad1	T	C	3: 89,403,183	R488G	probably damaging	Het
Galnt6	A	C	15: 100,693,355	*623E	probably null	Het
Gtf2e1	T	C	16: 37,511,454	T420A	possibly damaging	Het
Hspg2	T	C	4: 137,555,275	V3442A	probably damaging	Het
Itpr1	A	G	6: 108,388,276	D55G	probably damaging	Het
Kdm2a	C	A	19: 4,324,826	R759L	possibly damaging	Het
Kif19a	A	G	11: 114,785,779	E478G	probably damaging	Het
Lamb3	G	A	1: 193,335,453	V881I	probably benign	Het
Map3k6	T	C	4: 133,250,024	L894P	possibly damaging	Het
Mast4	A	G	13: 102,761,293		probably null	Het
Mst1r	G	A	9: 107,913,239	V684M	probably benign	Het
Naa15	T	C	3: 51,471,514	S727P	probably damaging	Het
Nav2	A	G	7: 49,597,533	T2205A	probably damaging	Het
Ncf2	T	C	1: 152,827,463		probably null	Het
Olfr1199	T	C	2: 88,756,108	D189G	probably damaging	Het
Olfr503	G	A	7: 108,544,995	V155I	probably benign	Het
Olfr622	T	C	7: 103,639,297	Y281C	probably damaging	Het
Opa1	T	A	16: 29,625,514	N839K	probably benign	Het
Pcdha7	T	C	18: 36,973,942	Y7H	possibly damaging	Het
Pcdhb15	T	C	18: 37,474,261	V182A	probably benign	Het
Phf10	A	T	17: 14,956,007	I128N	probably damaging	Het
Plce1	T	A	19: 38,748,521		probably null	Het
Plxnb2	T	C	15: 89,164,426	N626S	probably benign	Het
Prh1	G	A	6: 132,572,033	G168R	unknown	Het
Prss51	A	G	14: 64,097,406	T137A	possibly damaging	Het
Ptprcap	C	T	19: 4,156,184	R89C	possibly damaging	Het
Scfd1	A	G	12: 51,431,541	K512R	probably benign	Het
Serpina1b	A	C	12: 103,735,037		probably null	Het
Setbp1	T	C	18: 78,857,390	T1021A	probably damaging	Het
Slco1b2	G	A	6: 141,655,419		probably null	Het
Snrnp200	C	T	2: 127,221,827	T642I	probably benign	Het
Tenm4	A	C	7: 96,843,044	I1063L	possibly damaging	Het
Tfb2m	G	A	1: 179,546,046	A29V	probably benign	Het
Tfeb	T	C	17: 47,789,702	V140A	probably damaging	Het
Tmem104	A	T	11: 115,243,753	I372F	probably damaging	Het
Tmem132d	G	T	5: 127,783,768	H1096Q	probably benign	Het
Trim12c	A	T	7: 104,348,324	N8K	probably benign	Het
Tti2	A	G	8: 31,153,603	I249V	probably null	Het
Vps8	T	A	16: 21,442,379	L90I	probably damaging	Het
Vwf	A	T	6: 125,662,963		probably null	Het
Wdfy4	A	G	14: 33,146,944	S376P	probably damaging	Het

Other mutations in Nap1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01154:Nap1l1	APN	10	111486675	missense	probably damaging	0.98
IGL01453:Nap1l1	APN	10	111492978	missense	probably benign	0.09
IGL01734:Nap1l1	APN	10	111492899	missense	probably benign	0.26
IGL01843:Nap1l1	APN	10	111492911	missense	possibly damaging	0.93
PIT1430001:Nap1l1	UTSW	10	111486736	missense	probably damaging	1.00
PIT4131001:Nap1l1	UTSW	10	111486722	missense	probably null
R0020:Nap1l1	UTSW	10	111491023	missense	probably benign	0.01
R0020:Nap1l1	UTSW	10	111491023	missense	probably benign	0.01
R0131:Nap1l1	UTSW	10	111485509	missense	probably benign	0.17
R0131:Nap1l1	UTSW	10	111485509	missense	probably benign	0.17
R0132:Nap1l1	UTSW	10	111485509	missense	probably benign	0.17
R0601:Nap1l1	UTSW	10	111490363	splice site	probably benign
R1576:Nap1l1	UTSW	10	111494820	missense	probably damaging	1.00
R1619:Nap1l1	UTSW	10	111493379	missense	possibly damaging	0.77
R1969:Nap1l1	UTSW	10	111491053	missense	probably benign	0.03
R2071:Nap1l1	UTSW	10	111492900	missense	possibly damaging	0.46
R2383:Nap1l1	UTSW	10	111493411	missense	probably damaging	1.00
R3836:Nap1l1	UTSW	10	111495322	splice site	probably null
R3837:Nap1l1	UTSW	10	111495322	splice site	probably null
R3838:Nap1l1	UTSW	10	111495322	splice site	probably null
R3839:Nap1l1	UTSW	10	111495322	splice site	probably null
R4084:Nap1l1	UTSW	10	111490077	missense	possibly damaging	0.92
R4609:Nap1l1	UTSW	10	111492880	nonsense	probably null
R4985:Nap1l1	UTSW	10	111490083	missense	probably benign	0.01
R5906:Nap1l1	UTSW	10	111491030	nonsense	probably null
R5982:Nap1l1	UTSW	10	111495368	missense	possibly damaging	0.71
R6868:Nap1l1	UTSW	10	111494808	missense	probably damaging	1.00
R7134:Nap1l1	UTSW	10	111494794	critical splice acceptor site	probably null
R7202:Nap1l1	UTSW	10	111491103	missense	probably damaging	1.00
R7789:Nap1l1	UTSW	10	111490456	missense	probably benign	0.01
R7950:Nap1l1	UTSW	10	111492908	missense	probably damaging	1.00
R8404:Nap1l1	UTSW	10	111481301	start codon destroyed	probably null	0.53
R8502:Nap1l1	UTSW	10	111481301	start codon destroyed	probably null	0.53
R8933:Nap1l1	UTSW	10	111492849	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ACCAGTCCTAACTTCTATGTACTGC -3'
(R):5'- ATGAGCCCTGTATGTCCTACTAC -3'

Sequencing Primer
(F):5'- CTCGGTGTATATGCTGGCC -3'
(R):5'- TGTATGTCCTACTACAGCCAACCTAG -3'

Posted On

2018-06-06