Incidental Mutation 'R6522:Nap1l1'
List |< first << previous [record 29 of 58] next >> last >|
ID521392
Institutional Source Beutler Lab
Gene Symbol Nap1l1
Ensembl Gene ENSMUSG00000058799
Gene Namenucleosome assembly protein 1-like 1
SynonymsD10Ertd68e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R6522 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location111473223-111498150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111494223 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 330 (L330S)
Ref Sequence ENSEMBL: ENSMUSP00000151972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065917] [ENSMUST00000171797] [ENSMUST00000217908] [ENSMUST00000218828] [ENSMUST00000219143] [ENSMUST00000219961]
Predicted Effect probably damaging
Transcript: ENSMUST00000065917
AA Change: L330S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070068
Gene: ENSMUSG00000058799
AA Change: L330S

DomainStartEndE-ValueType
coiled coil region 6 31 N/A INTRINSIC
Pfam:NAP 75 346 1.5e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171797
AA Change: L357S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126850
Gene: ENSMUSG00000058799
AA Change: L357S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
coiled coil region 33 58 N/A INTRINSIC
Pfam:NAP 103 372 9.6e-110 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217908
AA Change: L330S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000218828
AA Change: L330S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218982
Predicted Effect possibly damaging
Transcript: ENSMUST00000219143
AA Change: L330S

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219718
Predicted Effect probably damaging
Transcript: ENSMUST00000219961
AA Change: L330S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleosome assembly protein (NAP) family. This protein participates in DNA replication and may play a role in modulating chromatin formation and contribute to the regulation of cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms; however, not all have been fully described. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C A 10: 10,377,892 E1209* probably null Het
Adgrg5 G T 8: 94,942,068 R503L probably benign Het
Anks1b C T 10: 90,897,327 probably benign Het
Anxa5 A T 3: 36,465,302 F13I probably damaging Het
Bicd1 A G 6: 149,484,005 I79V probably benign Het
Bnip1 A G 17: 26,789,745 D107G probably damaging Het
Ccdc42 A G 11: 68,588,220 E78G probably damaging Het
Ccnk A G 12: 108,187,187 D69G probably damaging Het
Clec2i G T 6: 128,893,729 V77F probably damaging Het
Clec4g A C 8: 3,718,803 V62G probably benign Het
Col4a4 G A 1: 82,487,583 A957V unknown Het
Csnk1d A G 11: 120,971,623 F277L probably damaging Het
Dip2c G A 13: 9,575,228 probably null Het
Dpf2 T A 19: 5,905,532 K108* probably null Het
Dync1h1 G A 12: 110,616,737 D423N probably damaging Het
Fbxl13 T C 5: 21,561,556 probably null Homo
Flad1 T C 3: 89,403,183 R488G probably damaging Het
Galnt6 A C 15: 100,693,355 *623E probably null Het
Gtf2e1 T C 16: 37,511,454 T420A possibly damaging Het
Hspg2 T C 4: 137,555,275 V3442A probably damaging Het
Itpr1 A G 6: 108,388,276 D55G probably damaging Het
Kdm2a C A 19: 4,324,826 R759L possibly damaging Het
Kif19a A G 11: 114,785,779 E478G probably damaging Het
Lamb3 G A 1: 193,335,453 V881I probably benign Het
Map3k6 T C 4: 133,250,024 L894P possibly damaging Het
Mast4 A G 13: 102,761,293 probably null Het
Mst1r G A 9: 107,913,239 V684M probably benign Het
Naa15 T C 3: 51,471,514 S727P probably damaging Het
Nav2 A G 7: 49,597,533 T2205A probably damaging Het
Ncf2 T C 1: 152,827,463 probably null Het
Olfr1199 T C 2: 88,756,108 D189G probably damaging Het
Olfr503 G A 7: 108,544,995 V155I probably benign Het
Olfr622 T C 7: 103,639,297 Y281C probably damaging Het
Opa1 T A 16: 29,625,514 N839K probably benign Het
Pcdha7 T C 18: 36,973,942 Y7H possibly damaging Het
Pcdhb15 T C 18: 37,474,261 V182A probably benign Het
Phf10 A T 17: 14,956,007 I128N probably damaging Het
Plce1 T A 19: 38,748,521 probably null Het
Plxnb2 T C 15: 89,164,426 N626S probably benign Het
Prh1 G A 6: 132,572,033 G168R unknown Het
Prss51 A G 14: 64,097,406 T137A possibly damaging Het
Ptprcap C T 19: 4,156,184 R89C possibly damaging Het
Scfd1 A G 12: 51,431,541 K512R probably benign Het
Serpina1b A C 12: 103,735,037 probably null Het
Setbp1 T C 18: 78,857,390 T1021A probably damaging Het
Slco1b2 G A 6: 141,655,419 probably null Het
Snrnp200 C T 2: 127,221,827 T642I probably benign Het
Tenm4 A C 7: 96,843,044 I1063L possibly damaging Het
Tfb2m G A 1: 179,546,046 A29V probably benign Het
Tfeb T C 17: 47,789,702 V140A probably damaging Het
Tmem104 A T 11: 115,243,753 I372F probably damaging Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Trim12c A T 7: 104,348,324 N8K probably benign Het
Tti2 A G 8: 31,153,603 I249V probably null Het
Vps8 T A 16: 21,442,379 L90I probably damaging Het
Vwf A T 6: 125,662,963 probably null Het
Wdfy4 A G 14: 33,146,944 S376P probably damaging Het
Other mutations in Nap1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Nap1l1 APN 10 111486675 missense probably damaging 0.98
IGL01453:Nap1l1 APN 10 111492978 missense probably benign 0.09
IGL01734:Nap1l1 APN 10 111492899 missense probably benign 0.26
IGL01843:Nap1l1 APN 10 111492911 missense possibly damaging 0.93
PIT1430001:Nap1l1 UTSW 10 111486736 missense probably damaging 1.00
PIT4131001:Nap1l1 UTSW 10 111486722 missense probably null
R0020:Nap1l1 UTSW 10 111491023 missense probably benign 0.01
R0020:Nap1l1 UTSW 10 111491023 missense probably benign 0.01
R0131:Nap1l1 UTSW 10 111485509 missense probably benign 0.17
R0131:Nap1l1 UTSW 10 111485509 missense probably benign 0.17
R0132:Nap1l1 UTSW 10 111485509 missense probably benign 0.17
R0601:Nap1l1 UTSW 10 111490363 splice site probably benign
R1576:Nap1l1 UTSW 10 111494820 missense probably damaging 1.00
R1619:Nap1l1 UTSW 10 111493379 missense possibly damaging 0.77
R1969:Nap1l1 UTSW 10 111491053 missense probably benign 0.03
R2071:Nap1l1 UTSW 10 111492900 missense possibly damaging 0.46
R2383:Nap1l1 UTSW 10 111493411 missense probably damaging 1.00
R3836:Nap1l1 UTSW 10 111495322 splice site probably null
R3837:Nap1l1 UTSW 10 111495322 splice site probably null
R3838:Nap1l1 UTSW 10 111495322 splice site probably null
R3839:Nap1l1 UTSW 10 111495322 splice site probably null
R4084:Nap1l1 UTSW 10 111490077 missense possibly damaging 0.92
R4609:Nap1l1 UTSW 10 111492880 nonsense probably null
R4985:Nap1l1 UTSW 10 111490083 missense probably benign 0.01
R5906:Nap1l1 UTSW 10 111491030 nonsense probably null
R5982:Nap1l1 UTSW 10 111495368 missense possibly damaging 0.71
R6868:Nap1l1 UTSW 10 111494808 missense probably damaging 1.00
R7134:Nap1l1 UTSW 10 111494794 critical splice acceptor site probably null
R7202:Nap1l1 UTSW 10 111491103 missense probably damaging 1.00
R7789:Nap1l1 UTSW 10 111490456 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCAGTCCTAACTTCTATGTACTGC -3'
(R):5'- ATGAGCCCTGTATGTCCTACTAC -3'

Sequencing Primer
(F):5'- CTCGGTGTATATGCTGGCC -3'
(R):5'- TGTATGTCCTACTACAGCCAACCTAG -3'
Posted On2018-06-06