Incidental Mutation 'R6548:Serpina1d'
ID521395
Institutional Source Beutler Lab
Gene Symbol Serpina1d
Ensembl Gene ENSMUSG00000071177
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 1D
SynonymsSpi1-4, PI4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6548 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location103763594-103773592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 103767552 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 164 (N164K)
Ref Sequence ENSEMBL: ENSMUSP00000077909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078869] [ENSMUST00000164454]
Predicted Effect probably damaging
Transcript: ENSMUST00000078869
AA Change: N164K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077909
Gene: ENSMUSG00000071177
AA Change: N164K

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
SERPIN 53 410 3.17e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164454
SMART Domains Protein: ENSMUSP00000127266
Gene: ENSMUSG00000071178

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 93% (38/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030612E09Rik T C 10: 43,174,773 L21P probably damaging Het
Ank3 C T 10: 69,892,410 A642V probably damaging Het
Bap1 A G 14: 31,256,225 N349S probably benign Het
Brca1 G T 11: 101,524,765 Q32K probably damaging Het
Ccdc39 A T 3: 33,837,959 N121K probably benign Het
Champ1 A T 8: 13,880,002 N720I probably damaging Het
Chd3 T A 11: 69,362,060 R216* probably null Het
D630003M21Rik A G 2: 158,205,699 probably null Het
Exoc2 A T 13: 30,826,064 V804E possibly damaging Het
Fcgbp A G 7: 28,091,918 N868S probably benign Het
Gm10376 T C 14: 43,015,568 M1V probably null Het
Gpc2 G A 5: 138,277,271 probably null Het
Gpr37 G A 6: 25,688,813 T95I probably benign Het
Ints3 G A 3: 90,392,124 probably benign Het
Krt28 T C 11: 99,367,013 E334G probably damaging Het
Lrrc75a T A 11: 62,606,095 T214S probably damaging Het
Lyar A G 5: 38,227,858 I81V probably benign Het
Mon2 A T 10: 123,036,093 L342Q probably damaging Het
Mug2 C T 6: 122,047,442 A491V probably damaging Het
Myh2 A G 11: 67,186,612 T858A probably benign Het
Net1 C T 13: 3,886,074 probably null Het
Olfr502 T C 7: 108,523,216 T245A probably benign Het
Olfr593 T A 7: 103,211,904 Y4N probably benign Het
Platr25 A T 13: 62,673,809 I110N possibly damaging Het
Plk5 T A 10: 80,363,045 L412H probably damaging Het
Rasal1 A T 5: 120,674,725 T605S probably benign Het
Ryr2 T A 13: 11,668,821 D3119V probably damaging Het
Serpina1a G T 12: 103,853,758 H387N probably benign Het
Smurf1 A G 5: 144,899,497 Y69H probably damaging Het
Sod2 A G 17: 13,008,363 K68R probably benign Het
Ssbp2 A G 13: 91,539,351 N51S possibly damaging Het
Tcl1b1 A G 12: 105,164,404 R49G probably benign Het
Tgfb1 A G 7: 25,696,925 I214M probably benign Het
Tln1 A G 4: 43,547,525 I812T probably damaging Het
Topaz1 T A 9: 122,748,354 C110S possibly damaging Het
Ubap2l A G 3: 90,023,560 F393L probably damaging Het
Vmn1r62 G A 7: 5,675,770 G150D probably damaging Het
Wdr24 C A 17: 25,827,925 Q651K probably damaging Het
Wdr7 A G 18: 63,778,251 T905A possibly damaging Het
Zfyve26 A G 12: 79,238,335 F2382S probably damaging Het
Other mutations in Serpina1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Serpina1d APN 12 103763734 missense probably benign 0.00
IGL02175:Serpina1d APN 12 103765696 splice site probably null
IGL02336:Serpina1d APN 12 103764796 nonsense probably null
IGL03260:Serpina1d APN 12 103763849 missense probably damaging 0.98
BB008:Serpina1d UTSW 12 103767556 missense probably damaging 0.99
BB018:Serpina1d UTSW 12 103767556 missense probably damaging 0.99
R0119:Serpina1d UTSW 12 103765757 missense probably damaging 1.00
R0299:Serpina1d UTSW 12 103765757 missense probably damaging 1.00
R0348:Serpina1d UTSW 12 103763775 missense probably benign 0.05
R0499:Serpina1d UTSW 12 103765757 missense probably damaging 1.00
R1086:Serpina1d UTSW 12 103763787 missense probably benign
R1864:Serpina1d UTSW 12 103767997 missense probably benign 0.21
R1883:Serpina1d UTSW 12 103765778 missense possibly damaging 0.64
R1884:Serpina1d UTSW 12 103765778 missense possibly damaging 0.64
R3731:Serpina1d UTSW 12 103767905 missense possibly damaging 0.63
R3973:Serpina1d UTSW 12 103767848 missense probably benign 0.01
R3976:Serpina1d UTSW 12 103767848 missense probably benign 0.01
R4227:Serpina1d UTSW 12 103767481 missense probably benign 0.03
R4783:Serpina1d UTSW 12 103767824 missense possibly damaging 0.87
R5672:Serpina1d UTSW 12 103763842 missense possibly damaging 0.69
R5764:Serpina1d UTSW 12 103765821 missense probably benign 0.00
R6244:Serpina1d UTSW 12 103764828 splice site probably null
R6314:Serpina1d UTSW 12 103764700 missense probably benign 0.39
R6554:Serpina1d UTSW 12 103764803 missense probably benign 0.09
R6953:Serpina1d UTSW 12 103767730 missense probably benign 0.00
R7106:Serpina1d UTSW 12 103765721 missense probably benign 0.01
R7390:Serpina1d UTSW 12 103767778 missense possibly damaging 0.86
R7931:Serpina1d UTSW 12 103767556 missense probably damaging 0.99
R8085:Serpina1d UTSW 12 103763828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCATGAGAGCTCAGAAACTG -3'
(R):5'- AAACATCGGAGGCTGACATC -3'

Sequencing Primer
(F):5'- CATGAGAGCTCAGAAACTGGTTCTC -3'
(R):5'- GGAGGCTGACATCCACAAGTC -3'
Posted On2018-06-06