Incidental Mutation 'R6522:Csnk1d'
ID521400
Institutional Source Beutler Lab
Gene Symbol Csnk1d
Ensembl Gene ENSMUSG00000025162
Gene Namecasein kinase 1, delta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6522 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120961749-120991330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120971623 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 277 (F277L)
Ref Sequence ENSEMBL: ENSMUSP00000070721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018274] [ENSMUST00000070575]
Predicted Effect probably damaging
Transcript: ENSMUST00000018274
AA Change: F277L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018274
Gene: ENSMUSG00000025162
AA Change: F277L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 3.7e-18 PFAM
Pfam:Pkinase 9 277 1.8e-28 PFAM
low complexity region 299 314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070575
AA Change: F277L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070721
Gene: ENSMUSG00000025162
AA Change: F277L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 1.6e-18 PFAM
Pfam:Pkinase 9 280 2.8e-41 PFAM
low complexity region 299 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141071
Predicted Effect probably benign
Transcript: ENSMUST00000146837
SMART Domains Protein: ENSMUSP00000115055
Gene: ENSMUSG00000025162

DomainStartEndE-ValueType
Pfam:Pkinase 2 55 6.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154483
SMART Domains Protein: ENSMUSP00000117472
Gene: ENSMUSG00000025162

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:Pkinase_Tyr 27 210 2.5e-12 PFAM
Pfam:Pkinase 28 218 3.4e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a member of the casein kinase I (CKI) family of serine/threonine protein kinases. A highly similar human protein regulates an array of cellular processes by influencing the Wnt and hedgehog signaling pathways. The encoded protein may also be involved in the regulation of apoptosis, circadian rhythm, microtubule dynamics, chromosome segregation, and p53-mediated effects on growth. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die 1.5 to 5 days after birth and fetal weight is significantly smaller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C A 10: 10,377,892 E1209* probably null Het
Adgrg5 G T 8: 94,942,068 R503L probably benign Het
Anks1b C T 10: 90,897,327 probably benign Het
Anxa5 A T 3: 36,465,302 F13I probably damaging Het
Bicd1 A G 6: 149,484,005 I79V probably benign Het
Bnip1 A G 17: 26,789,745 D107G probably damaging Het
Ccdc42 A G 11: 68,588,220 E78G probably damaging Het
Ccnk A G 12: 108,187,187 D69G probably damaging Het
Clec2i G T 6: 128,893,729 V77F probably damaging Het
Clec4g A C 8: 3,718,803 V62G probably benign Het
Col4a4 G A 1: 82,487,583 A957V unknown Het
Dip2c G A 13: 9,575,228 probably null Het
Dpf2 T A 19: 5,905,532 K108* probably null Het
Dync1h1 G A 12: 110,616,737 D423N probably damaging Het
Fbxl13 T C 5: 21,561,556 probably null Homo
Flad1 T C 3: 89,403,183 R488G probably damaging Het
Galnt6 A C 15: 100,693,355 *623E probably null Het
Gtf2e1 T C 16: 37,511,454 T420A possibly damaging Het
Hspg2 T C 4: 137,555,275 V3442A probably damaging Het
Itpr1 A G 6: 108,388,276 D55G probably damaging Het
Kdm2a C A 19: 4,324,826 R759L possibly damaging Het
Kif19a A G 11: 114,785,779 E478G probably damaging Het
Lamb3 G A 1: 193,335,453 V881I probably benign Het
Map3k6 T C 4: 133,250,024 L894P possibly damaging Het
Mast4 A G 13: 102,761,293 probably null Het
Mst1r G A 9: 107,913,239 V684M probably benign Het
Naa15 T C 3: 51,471,514 S727P probably damaging Het
Nap1l1 T C 10: 111,494,223 L330S probably damaging Het
Nav2 A G 7: 49,597,533 T2205A probably damaging Het
Ncf2 T C 1: 152,827,463 probably null Het
Olfr1199 T C 2: 88,756,108 D189G probably damaging Het
Olfr503 G A 7: 108,544,995 V155I probably benign Het
Olfr622 T C 7: 103,639,297 Y281C probably damaging Het
Opa1 T A 16: 29,625,514 N839K probably benign Het
Pcdha7 T C 18: 36,973,942 Y7H possibly damaging Het
Pcdhb15 T C 18: 37,474,261 V182A probably benign Het
Phf10 A T 17: 14,956,007 I128N probably damaging Het
Plce1 T A 19: 38,748,521 probably null Het
Plxnb2 T C 15: 89,164,426 N626S probably benign Het
Prh1 G A 6: 132,572,033 G168R unknown Het
Prss51 A G 14: 64,097,406 T137A possibly damaging Het
Ptprcap C T 19: 4,156,184 R89C possibly damaging Het
Scfd1 A G 12: 51,431,541 K512R probably benign Het
Serpina1b A C 12: 103,735,037 probably null Het
Setbp1 T C 18: 78,857,390 T1021A probably damaging Het
Slco1b2 G A 6: 141,655,419 probably null Het
Snrnp200 C T 2: 127,221,827 T642I probably benign Het
Tenm4 A C 7: 96,843,044 I1063L possibly damaging Het
Tfb2m G A 1: 179,546,046 A29V probably benign Het
Tfeb T C 17: 47,789,702 V140A probably damaging Het
Tmem104 A T 11: 115,243,753 I372F probably damaging Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Trim12c A T 7: 104,348,324 N8K probably benign Het
Tti2 A G 8: 31,153,603 I249V probably null Het
Vps8 T A 16: 21,442,379 L90I probably damaging Het
Vwf A T 6: 125,662,963 probably null Het
Wdfy4 A G 14: 33,146,944 S376P probably damaging Het
Other mutations in Csnk1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01689:Csnk1d APN 11 120971567 missense probably benign 0.06
IGL01905:Csnk1d APN 11 120973963 missense probably damaging 1.00
IGL02476:Csnk1d APN 11 120972512 missense probably damaging 1.00
R1971:Csnk1d UTSW 11 120972448 missense possibly damaging 0.95
R2245:Csnk1d UTSW 11 120972403 missense probably damaging 1.00
R4472:Csnk1d UTSW 11 120964974 unclassified probably benign
R4767:Csnk1d UTSW 11 120969128 missense probably benign
R4809:Csnk1d UTSW 11 120963842 unclassified probably benign
R4870:Csnk1d UTSW 11 120983188 intron probably benign
R6657:Csnk1d UTSW 11 120964994 missense possibly damaging 0.75
RF009:Csnk1d UTSW 11 120971627 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GTGACTTGCAAACCCGAGTC -3'
(R):5'- AGGCCAGATATGACTAGTCTTCAG -3'

Sequencing Primer
(F):5'- TTGCAAACCCGAGTCTTGCAG -3'
(R):5'- ATGACTAGTCTTCAGATTGTGTCTC -3'
Posted On2018-06-06