Incidental Mutation 'R6548:Exoc2'
ID 521405
Institutional Source Beutler Lab
Gene Symbol Exoc2
Ensembl Gene ENSMUSG00000021357
Gene Name exocyst complex component 2
Synonyms 2410030I24Rik, Sec5l1, Sec5
MMRRC Submission 044673-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R6548 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 30813919-30974093 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30826064 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 804 (V804E)
Ref Sequence ENSEMBL: ENSMUSP00000100010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]
AlphaFold Q9D4H1
Predicted Effect possibly damaging
Transcript: ENSMUST00000021785
AA Change: V804E

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: V804E

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102946
AA Change: V804E

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: V804E

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 93% (38/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030612E09Rik T C 10: 43,174,773 L21P probably damaging Het
Ank3 C T 10: 69,892,410 A642V probably damaging Het
Bap1 A G 14: 31,256,225 N349S probably benign Het
Brca1 G T 11: 101,524,765 Q32K probably damaging Het
Ccdc39 A T 3: 33,837,959 N121K probably benign Het
Champ1 A T 8: 13,880,002 N720I probably damaging Het
Chd3 T A 11: 69,362,060 R216* probably null Het
D630003M21Rik A G 2: 158,205,699 probably null Het
Fcgbp A G 7: 28,091,918 N868S probably benign Het
Gm10376 T C 14: 43,015,568 M1V probably null Het
Gpc2 G A 5: 138,277,271 probably null Het
Gpr37 G A 6: 25,688,813 T95I probably benign Het
Ints3 G A 3: 90,392,124 probably benign Het
Krt28 T C 11: 99,367,013 E334G probably damaging Het
Lrrc75a T A 11: 62,606,095 T214S probably damaging Het
Lyar A G 5: 38,227,858 I81V probably benign Het
Mon2 A T 10: 123,036,093 L342Q probably damaging Het
Mug2 C T 6: 122,047,442 A491V probably damaging Het
Myh2 A G 11: 67,186,612 T858A probably benign Het
Net1 C T 13: 3,886,074 probably null Het
Olfr502 T C 7: 108,523,216 T245A probably benign Het
Olfr593 T A 7: 103,211,904 Y4N probably benign Het
Platr25 A T 13: 62,673,809 I110N possibly damaging Het
Plk5 T A 10: 80,363,045 L412H probably damaging Het
Rasal1 A T 5: 120,674,725 T605S probably benign Het
Ryr2 T A 13: 11,668,821 D3119V probably damaging Het
Serpina1a G T 12: 103,853,758 H387N probably benign Het
Serpina1d G T 12: 103,767,552 N164K probably damaging Het
Smurf1 A G 5: 144,899,497 Y69H probably damaging Het
Sod2 A G 17: 13,008,363 K68R probably benign Het
Ssbp2 A G 13: 91,539,351 N51S possibly damaging Het
Tcl1b1 A G 12: 105,164,404 R49G probably benign Het
Tgfb1 A G 7: 25,696,925 I214M probably benign Het
Tln1 A G 4: 43,547,525 I812T probably damaging Het
Topaz1 T A 9: 122,748,354 C110S possibly damaging Het
Ubap2l A G 3: 90,023,560 F393L probably damaging Het
Vmn1r62 G A 7: 5,675,770 G150D probably damaging Het
Wdr24 C A 17: 25,827,925 Q651K probably damaging Het
Wdr7 A G 18: 63,778,251 T905A possibly damaging Het
Zfyve26 A G 12: 79,238,335 F2382S probably damaging Het
Other mutations in Exoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Exoc2 APN 13 30820626 missense probably benign 0.17
IGL01839:Exoc2 APN 13 30906799 missense probably damaging 1.00
IGL02092:Exoc2 APN 13 30875277 missense probably benign 0.09
IGL02245:Exoc2 APN 13 30906859 missense probably benign 0.10
IGL02267:Exoc2 APN 13 30815321 missense probably benign
IGL02478:Exoc2 APN 13 30927420 missense probably benign
IGL02500:Exoc2 APN 13 30911196 missense probably damaging 1.00
IGL03081:Exoc2 APN 13 30900902 missense probably benign 0.28
IGL03112:Exoc2 APN 13 30906587 splice site probably benign
IGL03409:Exoc2 APN 13 30940737 utr 5 prime probably benign
R0284:Exoc2 UTSW 13 30877625 splice site probably benign
R0452:Exoc2 UTSW 13 30886327 splice site probably benign
R0826:Exoc2 UTSW 13 30856797 critical splice acceptor site probably null
R1251:Exoc2 UTSW 13 30886276 missense probably benign 0.03
R1367:Exoc2 UTSW 13 30882273 nonsense probably null
R1501:Exoc2 UTSW 13 30935502 missense probably benign 0.01
R1593:Exoc2 UTSW 13 30856761 missense possibly damaging 0.64
R1839:Exoc2 UTSW 13 30906497 splice site probably benign
R1872:Exoc2 UTSW 13 30822661 missense probably benign 0.17
R2064:Exoc2 UTSW 13 30935561 missense probably benign 0.00
R2070:Exoc2 UTSW 13 30815370 missense probably benign 0.00
R2227:Exoc2 UTSW 13 30864884 missense probably benign
R2507:Exoc2 UTSW 13 30882365 missense possibly damaging 0.55
R3965:Exoc2 UTSW 13 30877582 missense probably benign 0.00
R4601:Exoc2 UTSW 13 30882268 missense probably benign 0.05
R4914:Exoc2 UTSW 13 30876813 missense probably benign 0.21
R5299:Exoc2 UTSW 13 30871918 splice site probably null
R5410:Exoc2 UTSW 13 30864856 missense probably damaging 0.98
R5461:Exoc2 UTSW 13 30925755 missense possibly damaging 0.66
R5956:Exoc2 UTSW 13 30820623 missense probably benign 0.03
R6056:Exoc2 UTSW 13 30900829 missense probably benign 0.03
R6107:Exoc2 UTSW 13 30876797 missense probably benign
R6692:Exoc2 UTSW 13 30935507 missense probably benign 0.09
R6969:Exoc2 UTSW 13 30911178 missense probably benign
R7386:Exoc2 UTSW 13 30906663 splice site probably null
R7461:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7467:Exoc2 UTSW 13 30925733 missense probably damaging 0.98
R7473:Exoc2 UTSW 13 30822630 critical splice donor site probably null
R7613:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7767:Exoc2 UTSW 13 30876769 missense probably benign 0.01
R7793:Exoc2 UTSW 13 30911178 missense probably benign 0.00
R7795:Exoc2 UTSW 13 30876773 nonsense probably null
R7993:Exoc2 UTSW 13 30906730 critical splice donor site probably null
R8085:Exoc2 UTSW 13 30940703 missense probably damaging 1.00
R8330:Exoc2 UTSW 13 30877573 missense probably benign
R8716:Exoc2 UTSW 13 30911244 missense probably damaging 1.00
R8735:Exoc2 UTSW 13 30906839 missense probably damaging 1.00
R8922:Exoc2 UTSW 13 30871855 missense probably benign 0.05
R9237:Exoc2 UTSW 13 30864875 missense probably benign
R9243:Exoc2 UTSW 13 30925795 missense probably benign 0.03
R9365:Exoc2 UTSW 13 30856714 missense probably benign 0.00
R9731:Exoc2 UTSW 13 30877250 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAGATGACAACTGTGTGGGAC -3'
(R):5'- AGACCAGTTCTCGTTGGAGC -3'

Sequencing Primer
(F):5'- GGAACCATGGGCAGTAACATCAC -3'
(R):5'- GGTTTTTACCTCTCTAGAAATAGTCC -3'
Posted On 2018-06-06