Incidental Mutation 'R6548:Sod2'
ID521415
Institutional Source Beutler Lab
Gene Symbol Sod2
Ensembl Gene ENSMUSG00000006818
Gene Namesuperoxide dismutase 2, mitochondrial
SynonymsMnSOD, manganese superoxide dismutase, manganese SOD, Sod-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6548 (G1)
Quality Score209.009
Status Validated
Chromosome17
Chromosomal Location13007839-13018119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13008363 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 68 (K68R)
Ref Sequence ENSEMBL: ENSMUSP00000007012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007012]
Predicted Effect probably benign
Transcript: ENSMUST00000007012
AA Change: K68R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000007012
Gene: ENSMUSG00000006818
AA Change: K68R

DomainStartEndE-ValueType
Pfam:Sod_Fe_N 25 106 1e-34 PFAM
Pfam:Sod_Fe_C 113 216 8.1e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 93% (38/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the iron/manganese superoxide dismutase family. It encodes a mitochondrial protein that forms a homotetramer and binds one manganese ion per subunit. This protein binds to the superoxide byproducts of oxidative phosphorylation and converts them to hydrogen peroxide and diatomic oxygen. Mutations in this gene have been associated with idiopathic cardiomyopathy (IDC), premature aging, sporadic motor neuron disease, and cancer. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 1. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mutations affect mitochondrial function. Null homozygotes die early with cardiomyopathy, tissue lipid accumulation, neurodegeneration, motor problems and/or metabolic acidosis depending on strain background. Heterozygotes show mitochondria and apoptosis defects with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030612E09Rik T C 10: 43,174,773 L21P probably damaging Het
Ank3 C T 10: 69,892,410 A642V probably damaging Het
Bap1 A G 14: 31,256,225 N349S probably benign Het
Brca1 G T 11: 101,524,765 Q32K probably damaging Het
Ccdc39 A T 3: 33,837,959 N121K probably benign Het
Champ1 A T 8: 13,880,002 N720I probably damaging Het
Chd3 T A 11: 69,362,060 R216* probably null Het
D630003M21Rik A G 2: 158,205,699 probably null Het
Exoc2 A T 13: 30,826,064 V804E possibly damaging Het
Fcgbp A G 7: 28,091,918 N868S probably benign Het
Gm10376 T C 14: 43,015,568 M1V probably null Het
Gpc2 G A 5: 138,277,271 probably null Het
Gpr37 G A 6: 25,688,813 T95I probably benign Het
Ints3 G A 3: 90,392,124 probably benign Het
Krt28 T C 11: 99,367,013 E334G probably damaging Het
Lrrc75a T A 11: 62,606,095 T214S probably damaging Het
Lyar A G 5: 38,227,858 I81V probably benign Het
Mon2 A T 10: 123,036,093 L342Q probably damaging Het
Mug2 C T 6: 122,047,442 A491V probably damaging Het
Myh2 A G 11: 67,186,612 T858A probably benign Het
Net1 C T 13: 3,886,074 probably null Het
Olfr502 T C 7: 108,523,216 T245A probably benign Het
Olfr593 T A 7: 103,211,904 Y4N probably benign Het
Platr25 A T 13: 62,673,809 I110N possibly damaging Het
Plk5 T A 10: 80,363,045 L412H probably damaging Het
Rasal1 A T 5: 120,674,725 T605S probably benign Het
Ryr2 T A 13: 11,668,821 D3119V probably damaging Het
Serpina1a G T 12: 103,853,758 H387N probably benign Het
Serpina1d G T 12: 103,767,552 N164K probably damaging Het
Smurf1 A G 5: 144,899,497 Y69H probably damaging Het
Ssbp2 A G 13: 91,539,351 N51S possibly damaging Het
Tcl1b1 A G 12: 105,164,404 R49G probably benign Het
Tgfb1 A G 7: 25,696,925 I214M probably benign Het
Tln1 A G 4: 43,547,525 I812T probably damaging Het
Topaz1 T A 9: 122,748,354 C110S possibly damaging Het
Ubap2l A G 3: 90,023,560 F393L probably damaging Het
Vmn1r62 G A 7: 5,675,770 G150D probably damaging Het
Wdr24 C A 17: 25,827,925 Q651K probably damaging Het
Wdr7 A G 18: 63,778,251 T905A possibly damaging Het
Zfyve26 A G 12: 79,238,335 F2382S probably damaging Het
Other mutations in Sod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Sod2 APN 17 13013577 missense possibly damaging 0.83
IGL03170:Sod2 APN 17 13008370 missense probably benign
R0735:Sod2 UTSW 17 13010564 missense probably damaging 1.00
R1775:Sod2 UTSW 17 13015032 missense probably damaging 0.96
R1909:Sod2 UTSW 17 13015169 makesense probably null
R4928:Sod2 UTSW 17 13008186 missense probably benign 0.30
R6083:Sod2 UTSW 17 13008031 start gained probably benign
R6670:Sod2 UTSW 17 13008365 missense possibly damaging 0.95
R7526:Sod2 UTSW 17 13008031 start gained probably benign
Z1088:Sod2 UTSW 17 13013538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATAATGTTGTGTCGGGCG -3'
(R):5'- AAGGTCCGTCAAGTACTTTCG -3'

Sequencing Primer
(F):5'- TGTTCCTCTCAGCACGGG -3'
(R):5'- CCGTCAAGTACTTTCGTGAGGTC -3'
Posted On2018-06-06