Mutagenetix > Incidental Mutations

Incidental Mutation 'R6522:Plxnb2'

521416

Institutional Source

Beutler Lab

Gene Symbol

Plxnb2

Ensembl Gene

ENSMUSG00000036606

Gene Name

plexin B2

Synonyms

Debt, 1110007H23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R6522 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89155549-89180788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89164426 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 626 (N626S)

Ref Sequence

ENSEMBL: ENSMUSP00000104955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]

Predicted Effect

probably benign
Transcript: ENSMUST00000060808
AA Change: N626S

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: N626S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1275	1809	1.6e-225	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109331
AA Change: N626S

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: N626S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1274	1809	4.4e-251	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131062

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197760

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.3%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	C	A	10: 10,377,892	E1209*	probably null	Het
Adgrg5	G	T	8: 94,942,068	R503L	probably benign	Het
Anks1b	C	T	10: 90,897,327		probably benign	Het
Anxa5	A	T	3: 36,465,302	F13I	probably damaging	Het
Bicd1	A	G	6: 149,484,005	I79V	probably benign	Het
Bnip1	A	G	17: 26,789,745	D107G	probably damaging	Het
Ccdc42	A	G	11: 68,588,220	E78G	probably damaging	Het
Ccnk	A	G	12: 108,187,187	D69G	probably damaging	Het
Clec2i	G	T	6: 128,893,729	V77F	probably damaging	Het
Clec4g	A	C	8: 3,718,803	V62G	probably benign	Het
Col4a4	G	A	1: 82,487,583	A957V	unknown	Het
Csnk1d	A	G	11: 120,971,623	F277L	probably damaging	Het
Dip2c	G	A	13: 9,575,228		probably null	Het
Dpf2	T	A	19: 5,905,532	K108*	probably null	Het
Dync1h1	G	A	12: 110,616,737	D423N	probably damaging	Het
Fbxl13	T	C	5: 21,561,556		probably null	Homo
Flad1	T	C	3: 89,403,183	R488G	probably damaging	Het
Galnt6	A	C	15: 100,693,355	*623E	probably null	Het
Gtf2e1	T	C	16: 37,511,454	T420A	possibly damaging	Het
Hspg2	T	C	4: 137,555,275	V3442A	probably damaging	Het
Itpr1	A	G	6: 108,388,276	D55G	probably damaging	Het
Kdm2a	C	A	19: 4,324,826	R759L	possibly damaging	Het
Kif19a	A	G	11: 114,785,779	E478G	probably damaging	Het
Lamb3	G	A	1: 193,335,453	V881I	probably benign	Het
Map3k6	T	C	4: 133,250,024	L894P	possibly damaging	Het
Mast4	A	G	13: 102,761,293		probably null	Het
Mst1r	G	A	9: 107,913,239	V684M	probably benign	Het
Naa15	T	C	3: 51,471,514	S727P	probably damaging	Het
Nap1l1	T	C	10: 111,494,223	L330S	probably damaging	Het
Nav2	A	G	7: 49,597,533	T2205A	probably damaging	Het
Ncf2	T	C	1: 152,827,463		probably null	Het
Olfr1199	T	C	2: 88,756,108	D189G	probably damaging	Het
Olfr503	G	A	7: 108,544,995	V155I	probably benign	Het
Olfr622	T	C	7: 103,639,297	Y281C	probably damaging	Het
Opa1	T	A	16: 29,625,514	N839K	probably benign	Het
Pcdha7	T	C	18: 36,973,942	Y7H	possibly damaging	Het
Pcdhb15	T	C	18: 37,474,261	V182A	probably benign	Het
Phf10	A	T	17: 14,956,007	I128N	probably damaging	Het
Plce1	T	A	19: 38,748,521		probably null	Het
Prh1	G	A	6: 132,572,033	G168R	unknown	Het
Prss51	A	G	14: 64,097,406	T137A	possibly damaging	Het
Ptprcap	C	T	19: 4,156,184	R89C	possibly damaging	Het
Scfd1	A	G	12: 51,431,541	K512R	probably benign	Het
Serpina1b	A	C	12: 103,735,037		probably null	Het
Setbp1	T	C	18: 78,857,390	T1021A	probably damaging	Het
Slco1b2	G	A	6: 141,655,419		probably null	Het
Snrnp200	C	T	2: 127,221,827	T642I	probably benign	Het
Tenm4	A	C	7: 96,843,044	I1063L	possibly damaging	Het
Tfb2m	G	A	1: 179,546,046	A29V	probably benign	Het
Tfeb	T	C	17: 47,789,702	V140A	probably damaging	Het
Tmem104	A	T	11: 115,243,753	I372F	probably damaging	Het
Tmem132d	G	T	5: 127,783,768	H1096Q	probably benign	Het
Trim12c	A	T	7: 104,348,324	N8K	probably benign	Het
Tti2	A	G	8: 31,153,603	I249V	probably null	Het
Vps8	T	A	16: 21,442,379	L90I	probably damaging	Het
Vwf	A	T	6: 125,662,963		probably null	Het
Wdfy4	A	G	14: 33,146,944	S376P	probably damaging	Het

Other mutations in Plxnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Plxnb2	APN	15	89162366	splice site	probably benign
IGL01574:Plxnb2	APN	15	89162683	splice site	probably null
IGL01695:Plxnb2	APN	15	89157214	missense	possibly damaging	0.96
IGL01763:Plxnb2	APN	15	89161981	splice site	probably null
IGL01921:Plxnb2	APN	15	89164271	missense	possibly damaging	0.78
IGL02129:Plxnb2	APN	15	89160410	missense	probably benign	0.04
IGL02153:Plxnb2	APN	15	89165813	nonsense	probably null
IGL02637:Plxnb2	APN	15	89164057	missense	possibly damaging	0.53
IGL02892:Plxnb2	APN	15	89161222	critical splice donor site	probably null
IGL03108:Plxnb2	APN	15	89158031	missense	probably benign	0.32
IGL03115:Plxnb2	APN	15	89162438	splice site	probably benign
P0040:Plxnb2	UTSW	15	89162935	missense	probably damaging	1.00
R0022:Plxnb2	UTSW	15	89163276	critical splice donor site	probably null
R0095:Plxnb2	UTSW	15	89165331	missense	probably benign
R0103:Plxnb2	UTSW	15	89161769	missense	possibly damaging	0.85
R0544:Plxnb2	UTSW	15	89158613	splice site	probably benign
R0671:Plxnb2	UTSW	15	89157981	missense	probably benign	0.14
R1279:Plxnb2	UTSW	15	89162321	missense	probably benign	0.02
R1530:Plxnb2	UTSW	15	89167192	missense	probably benign
R1542:Plxnb2	UTSW	15	89165921	missense	probably damaging	1.00
R1610:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R1686:Plxnb2	UTSW	15	89162462	missense	probably damaging	1.00
R1702:Plxnb2	UTSW	15	89161984	critical splice donor site	probably null
R1996:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R1997:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R2031:Plxnb2	UTSW	15	89162810	nonsense	probably null
R2049:Plxnb2	UTSW	15	89159002	missense	probably damaging	1.00
R2072:Plxnb2	UTSW	15	89158451	missense	probably damaging	1.00
R2076:Plxnb2	UTSW	15	89158026	missense	probably damaging	1.00
R2140:Plxnb2	UTSW	15	89156562	missense	probably benign	0.04
R2418:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R2419:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R3752:Plxnb2	UTSW	15	89157255	splice site	probably benign
R3825:Plxnb2	UTSW	15	89166399	missense	probably benign	0.05
R4154:Plxnb2	UTSW	15	89159642	missense	probably damaging	0.98
R4197:Plxnb2	UTSW	15	89157018	missense	probably damaging	1.00
R4385:Plxnb2	UTSW	15	89160623	missense	probably damaging	0.96
R4434:Plxnb2	UTSW	15	89162803	missense	probably damaging	1.00
R4678:Plxnb2	UTSW	15	89160928	missense	probably benign	0.37
R4717:Plxnb2	UTSW	15	89157419	nonsense	probably null
R4773:Plxnb2	UTSW	15	89166947	missense	probably benign	0.06
R4905:Plxnb2	UTSW	15	89157411	missense	probably damaging	1.00
R5368:Plxnb2	UTSW	15	89159593	missense	possibly damaging	0.94
R5418:Plxnb2	UTSW	15	89166491	missense	probably benign	0.00
R5484:Plxnb2	UTSW	15	89164209	splice site	probably null
R5520:Plxnb2	UTSW	15	89167543	missense	possibly damaging	0.65
R5566:Plxnb2	UTSW	15	89164020	missense	probably benign	0.05
R5568:Plxnb2	UTSW	15	89157435	missense	probably damaging	1.00
R5619:Plxnb2	UTSW	15	89162809	missense	possibly damaging	0.92
R5685:Plxnb2	UTSW	15	89167032	missense	probably damaging	1.00
R5688:Plxnb2	UTSW	15	89158696	missense	probably damaging	1.00
R5809:Plxnb2	UTSW	15	89167571	missense	possibly damaging	0.61
R5813:Plxnb2	UTSW	15	89160759	missense	possibly damaging	0.81
R5866:Plxnb2	UTSW	15	89167572	missense	probably damaging	1.00
R6016:Plxnb2	UTSW	15	89161022	missense	possibly damaging	0.55
R6117:Plxnb2	UTSW	15	89158000	missense	probably benign	0.04
R6187:Plxnb2	UTSW	15	89167258	missense	probably damaging	1.00
R6260:Plxnb2	UTSW	15	89165291	missense	probably benign	0.22
R6263:Plxnb2	UTSW	15	89161986	missense	probably damaging	0.99
R6269:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
R6351:Plxnb2	UTSW	15	89157770	missense	possibly damaging	0.95
R6856:Plxnb2	UTSW	15	89164320	missense	probably benign	0.27
R6930:Plxnb2	UTSW	15	89160389	missense	probably benign
R7354:Plxnb2	UTSW	15	89165725	missense	possibly damaging	0.92
R7513:Plxnb2	UTSW	15	89158322	critical splice acceptor site	probably null
R7522:Plxnb2	UTSW	15	89161774	missense	probably benign	0.20
R7730:Plxnb2	UTSW	15	89162330	missense	probably benign
R7766:Plxnb2	UTSW	15	89161271	missense	probably benign	0.01
R7781:Plxnb2	UTSW	15	89157022	missense	possibly damaging	0.89
R8126:Plxnb2	UTSW	15	89163303	missense	probably benign
R8131:Plxnb2	UTSW	15	89158713	missense	probably damaging	1.00
R8372:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
X0027:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
Z1177:Plxnb2	UTSW	15	89159096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCGACACTCGTAGTACTG -3'
(R):5'- GGGGTATCCATATTGTATCCCC -3'

Sequencing Primer
(F):5'- ACACTCGTAGTACTGCAGGTC -3'
(R):5'- AGAATAGACCTCCTCTCCGCTGG -3'

Posted On

2018-06-06