Incidental Mutation 'R6522:Galnt6'
List |< first << previous [record 18 of 58] next >> last >|
ID521418
Institutional Source Beutler Lab
Gene Symbol Galnt6
Ensembl Gene ENSMUSG00000037280
Gene Namepolypeptide N-acetylgalactosaminyltransferase 6
SynonymsGalNAc-T6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R6522 (G1)
Quality Score202.009
Status Validated
Chromosome15
Chromosomal Location100691813-100729376 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to C at 100693355 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamic Acid at position 623 (*623E)
Ref Sequence ENSEMBL: ENSMUSP00000124793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052069] [ENSMUST00000159715] [ENSMUST00000161514]
Predicted Effect probably null
Transcript: ENSMUST00000052069
AA Change: *623E
SMART Domains Protein: ENSMUSP00000056705
Gene: ENSMUSG00000037280
AA Change: *623E

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 177 431 4.2e-10 PFAM
Pfam:Glycos_transf_2 180 366 8.8e-36 PFAM
Pfam:Glyco_transf_7C 337 415 8.5e-14 PFAM
RICIN 496 622 1.53e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159715
AA Change: *623E
SMART Domains Protein: ENSMUSP00000123848
Gene: ENSMUSG00000037280
AA Change: *623E

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 177 432 1e-10 PFAM
Pfam:Glycos_transf_2 180 366 4.1e-31 PFAM
Pfam:Glyco_transf_7C 337 415 6.7e-13 PFAM
RICIN 496 622 1.53e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160960
Predicted Effect probably null
Transcript: ENSMUST00000161514
AA Change: *623E
SMART Domains Protein: ENSMUSP00000124793
Gene: ENSMUSG00000037280
AA Change: *623E

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 177 431 4.2e-10 PFAM
Pfam:Glycos_transf_2 180 366 8.8e-36 PFAM
Pfam:Glyco_transf_7C 337 415 8.5e-14 PFAM
RICIN 496 622 1.53e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229410
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. The encoded protein is capable of glycosylating fibronectin peptide in vitro and is expressed in a fibroblast cell line, indicating that it may be involved in the synthesis of oncofetal fibronectin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C A 10: 10,377,892 E1209* probably null Het
Adgrg5 G T 8: 94,942,068 R503L probably benign Het
Anks1b C T 10: 90,897,327 probably benign Het
Anxa5 A T 3: 36,465,302 F13I probably damaging Het
Bicd1 A G 6: 149,484,005 I79V probably benign Het
Bnip1 A G 17: 26,789,745 D107G probably damaging Het
Ccdc42 A G 11: 68,588,220 E78G probably damaging Het
Ccnk A G 12: 108,187,187 D69G probably damaging Het
Clec2i G T 6: 128,893,729 V77F probably damaging Het
Clec4g A C 8: 3,718,803 V62G probably benign Het
Col4a4 G A 1: 82,487,583 A957V unknown Het
Csnk1d A G 11: 120,971,623 F277L probably damaging Het
Dip2c G A 13: 9,575,228 probably null Het
Dpf2 T A 19: 5,905,532 K108* probably null Het
Dync1h1 G A 12: 110,616,737 D423N probably damaging Het
Fbxl13 T C 5: 21,561,556 probably null Homo
Flad1 T C 3: 89,403,183 R488G probably damaging Het
Gtf2e1 T C 16: 37,511,454 T420A possibly damaging Het
Hspg2 T C 4: 137,555,275 V3442A probably damaging Het
Itpr1 A G 6: 108,388,276 D55G probably damaging Het
Kdm2a C A 19: 4,324,826 R759L possibly damaging Het
Kif19a A G 11: 114,785,779 E478G probably damaging Het
Lamb3 G A 1: 193,335,453 V881I probably benign Het
Map3k6 T C 4: 133,250,024 L894P possibly damaging Het
Mast4 A G 13: 102,761,293 probably null Het
Mst1r G A 9: 107,913,239 V684M probably benign Het
Naa15 T C 3: 51,471,514 S727P probably damaging Het
Nap1l1 T C 10: 111,494,223 L330S probably damaging Het
Nav2 A G 7: 49,597,533 T2205A probably damaging Het
Ncf2 T C 1: 152,827,463 probably null Het
Olfr1199 T C 2: 88,756,108 D189G probably damaging Het
Olfr503 G A 7: 108,544,995 V155I probably benign Het
Olfr622 T C 7: 103,639,297 Y281C probably damaging Het
Opa1 T A 16: 29,625,514 N839K probably benign Het
Pcdha7 T C 18: 36,973,942 Y7H possibly damaging Het
Pcdhb15 T C 18: 37,474,261 V182A probably benign Het
Phf10 A T 17: 14,956,007 I128N probably damaging Het
Plce1 T A 19: 38,748,521 probably null Het
Plxnb2 T C 15: 89,164,426 N626S probably benign Het
Prh1 G A 6: 132,572,033 G168R unknown Het
Prss51 A G 14: 64,097,406 T137A possibly damaging Het
Ptprcap C T 19: 4,156,184 R89C possibly damaging Het
Scfd1 A G 12: 51,431,541 K512R probably benign Het
Serpina1b A C 12: 103,735,037 probably null Het
Setbp1 T C 18: 78,857,390 T1021A probably damaging Het
Slco1b2 G A 6: 141,655,419 probably null Het
Snrnp200 C T 2: 127,221,827 T642I probably benign Het
Tenm4 A C 7: 96,843,044 I1063L possibly damaging Het
Tfb2m G A 1: 179,546,046 A29V probably benign Het
Tfeb T C 17: 47,789,702 V140A probably damaging Het
Tmem104 A T 11: 115,243,753 I372F probably damaging Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Trim12c A T 7: 104,348,324 N8K probably benign Het
Tti2 A G 8: 31,153,603 I249V probably null Het
Vps8 T A 16: 21,442,379 L90I probably damaging Het
Vwf A T 6: 125,662,963 probably null Het
Wdfy4 A G 14: 33,146,944 S376P probably damaging Het
Other mutations in Galnt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02024:Galnt6 APN 15 100703493 missense probably benign 0.16
IGL02606:Galnt6 APN 15 100714219 missense probably damaging 1.00
R0325:Galnt6 UTSW 15 100693471 splice site probably null
R0336:Galnt6 UTSW 15 100699206 missense probably damaging 0.99
R0504:Galnt6 UTSW 15 100696657 splice site probably benign
R1563:Galnt6 UTSW 15 100703378 missense probably benign 0.00
R1903:Galnt6 UTSW 15 100716118 missense possibly damaging 0.79
R2007:Galnt6 UTSW 15 100697166 missense probably damaging 1.00
R2114:Galnt6 UTSW 15 100714241 missense probably damaging 1.00
R2943:Galnt6 UTSW 15 100714279 splice site probably null
R3410:Galnt6 UTSW 15 100699137 missense probably damaging 1.00
R3954:Galnt6 UTSW 15 100697168 missense possibly damaging 0.72
R4754:Galnt6 UTSW 15 100699224 missense probably damaging 1.00
R4910:Galnt6 UTSW 15 100716178 missense probably benign
R4911:Galnt6 UTSW 15 100716178 missense probably benign
R4962:Galnt6 UTSW 15 100696574 nonsense probably null
R5237:Galnt6 UTSW 15 100693393 missense probably damaging 1.00
R5293:Galnt6 UTSW 15 100703501 missense probably benign 0.00
R5605:Galnt6 UTSW 15 100697225 missense probably damaging 1.00
R5752:Galnt6 UTSW 15 100704126 missense probably damaging 1.00
R5837:Galnt6 UTSW 15 100694646 missense possibly damaging 0.70
R5949:Galnt6 UTSW 15 100696550 missense probably damaging 1.00
R6051:Galnt6 UTSW 15 100694668 missense probably damaging 1.00
R6306:Galnt6 UTSW 15 100693424 missense possibly damaging 0.70
R6959:Galnt6 UTSW 15 100714125 missense probably damaging 0.99
R7154:Galnt6 UTSW 15 100693464 missense probably benign 0.05
R7450:Galnt6 UTSW 15 100697815 missense probably damaging 1.00
R7834:Galnt6 UTSW 15 100714103 missense probably damaging 1.00
R7908:Galnt6 UTSW 15 100703361 missense probably damaging 1.00
R7917:Galnt6 UTSW 15 100714103 missense probably damaging 1.00
R7989:Galnt6 UTSW 15 100703361 missense probably damaging 1.00
R8143:Galnt6 UTSW 15 100716207 missense probably damaging 0.98
R8212:Galnt6 UTSW 15 100693427 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GGGACCAGTGTTGTTGCAAG -3'
(R):5'- CAGGCTAAAGCTGCTGTGTG -3'

Sequencing Primer
(F):5'- GAAGAACATCCTGCCTTGGTG -3'
(R):5'- TCAGAATCAGAATCGGAATCGG -3'
Posted On2018-06-06