Incidental Mutation 'R6549:Fam126b'
ID521421
Institutional Source Beutler Lab
Gene Symbol Fam126b
Ensembl Gene ENSMUSG00000038174
Gene Namefamily with sequence similarity 126, member B
SynonymsD1Ertd53e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.710) question?
Stock #R6549 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location58522806-58586323 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58539600 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 264 (I264V)
Ref Sequence ENSEMBL: ENSMUSP00000123728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038372] [ENSMUST00000097724] [ENSMUST00000161600] [ENSMUST00000187717]
Predicted Effect probably benign
Transcript: ENSMUST00000038372
AA Change: I264V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000038718
Gene: ENSMUSG00000038174
AA Change: I264V

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 1.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097724
AA Change: I264V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000095331
Gene: ENSMUSG00000038174
AA Change: I264V

DomainStartEndE-ValueType
Pfam:Hyccin 22 330 3.3e-126 PFAM
low complexity region 374 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161600
AA Change: I264V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123728
Gene: ENSMUSG00000038174
AA Change: I264V

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 1.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187717
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm T C 9: 53,493,177 D1288G probably benign Het
Atxn7 T C 14: 14,013,087 S2P probably damaging Het
C1rl T A 6: 124,508,528 I286N probably benign Het
Ccdc54 T C 16: 50,590,025 R293G possibly damaging Het
Cndp1 A T 18: 84,636,184 I85K probably benign Het
Col25a1 A G 3: 130,182,795 T110A probably benign Het
Defb8 G T 8: 19,447,544 P17Q probably damaging Het
Dnah1 A T 14: 31,269,383 L3146Q probably damaging Het
Espn A T 4: 152,131,068 M1K probably null Het
Gm9922 C A 14: 101,729,457 probably benign Het
Ldb3 A G 14: 34,541,897 M545T probably damaging Het
Olfr1076 A T 2: 86,509,382 I308L probably benign Het
Piezo1 G A 8: 122,500,263 H420Y probably benign Het
Primpol A T 8: 46,605,150 L115I probably damaging Het
Pus10 G A 11: 23,729,075 probably null Het
Rictor C G 15: 6,796,175 A1689G probably damaging Het
Scn2a A G 2: 65,764,674 N1956D probably benign Het
Scn4a T C 11: 106,343,965 D384G probably damaging Het
Sell A G 1: 164,065,629 D138G probably damaging Het
Slc4a7 T A 14: 14,748,564 F327L probably damaging Het
Sox6 A G 7: 115,486,692 I680T possibly damaging Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Vmn1r31 A T 6: 58,472,663 N72K possibly damaging Het
Vmn2r77 A G 7: 86,800,857 I104V probably benign Het
Zfp988 G A 4: 147,331,853 C248Y probably benign Het
Other mutations in Fam126b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Fam126b APN 1 58540253 splice site probably benign
IGL00468:Fam126b APN 1 58530232 missense probably benign 0.25
IGL00701:Fam126b APN 1 58535482 missense possibly damaging 0.59
IGL00795:Fam126b APN 1 58552179 missense probably damaging 1.00
IGL02023:Fam126b APN 1 58530115 missense possibly damaging 0.53
IGL02501:Fam126b APN 1 58540191 missense probably damaging 1.00
IGL02657:Fam126b APN 1 58535402 missense probably damaging 1.00
IGL02970:Fam126b APN 1 58539617 missense probably damaging 1.00
IGL03221:Fam126b APN 1 58540186 missense probably benign 0.00
IGL03240:Fam126b APN 1 58529917 missense probably damaging 1.00
PIT4812001:Fam126b UTSW 1 58548703 missense possibly damaging 0.78
R0455:Fam126b UTSW 1 58534479 splice site probably benign
R1479:Fam126b UTSW 1 58552268 nonsense probably null
R1529:Fam126b UTSW 1 58539607 missense probably benign 0.00
R4275:Fam126b UTSW 1 58529933 missense probably benign
R5164:Fam126b UTSW 1 58535438 missense probably benign 0.13
R6332:Fam126b UTSW 1 58529875 missense probably damaging 0.99
R6352:Fam126b UTSW 1 58557312 missense probably damaging 1.00
R7034:Fam126b UTSW 1 58535537 missense probably benign 0.17
R7036:Fam126b UTSW 1 58535537 missense probably benign 0.17
R7100:Fam126b UTSW 1 58534494 missense possibly damaging 0.94
R7237:Fam126b UTSW 1 58529948 nonsense probably null
R7378:Fam126b UTSW 1 58530034 missense probably benign 0.00
R7403:Fam126b UTSW 1 58548702 missense possibly damaging 0.59
R8015:Fam126b UTSW 1 58535482 missense possibly damaging 0.59
R8249:Fam126b UTSW 1 58534637 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGATTTCAAACCATGCCTCCC -3'
(R):5'- TGATAACTTGGAAGTGAGAGCTTTG -3'

Sequencing Primer
(F):5'- CAAGCTGGCTTTGAACTCAG -3'
(R):5'- GGAAGTACTAAGTGATCCATCC -3'
Posted On2018-06-06