Incidental Mutation 'R6522:Opa1'
List |< first << previous [record 35 of 58] next >> last >|
ID521422
Institutional Source Beutler Lab
Gene Symbol Opa1
Ensembl Gene ENSMUSG00000038084
Gene NameOPA1, mitochondrial dynamin like GTPase
Synonyms1200011N24Rik, lilr3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6522 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location29579334-29654884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29625514 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 839 (N839K)
Ref Sequence ENSEMBL: ENSMUSP00000123880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038867] [ENSMUST00000160475] [ENSMUST00000160597] [ENSMUST00000161186]
Predicted Effect probably benign
Transcript: ENSMUST00000038867
AA Change: N820K

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000036993
Gene: ENSMUSG00000038084
AA Change: N820K

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
low complexity region 189 205 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
DYNc 283 533 2.18e-10 SMART
coiled coil region 918 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160153
Predicted Effect probably benign
Transcript: ENSMUST00000160475
SMART Domains Protein: ENSMUSP00000124739
Gene: ENSMUSG00000038084

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
low complexity region 189 205 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
DYNc 283 533 2.18e-10 SMART
Blast:DYNc 608 632 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160597
AA Change: N802K

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124223
Gene: ENSMUSG00000038084
AA Change: N802K

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
coiled coil region 210 253 N/A INTRINSIC
DYNc 265 515 2.18e-10 SMART
coiled coil region 900 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161186
AA Change: N839K

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123880
Gene: ENSMUSG00000038084
AA Change: N839K

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 91 101 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
DYNc 302 552 2.18e-10 SMART
coiled coil region 937 986 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a nuclear-encoded mitochondrial protein with similarity to dynamin-related GTPases. It is a component of the mitochondrial network. Mutations in this gene have been associated with optic atrophy type 1, which is a dominantly inherited optic neuropathy resulting in progressive loss of visual acuity, leading in many cases to legal blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit embryonic lethality, embryonic growth retardation and morphological abnormalities. Mice heterozygous for an ENU mutation exhibit abnormal cellular morphology, altered optic nerve myelination, abnormal responseto a new environment and decreased vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C A 10: 10,377,892 E1209* probably null Het
Adgrg5 G T 8: 94,942,068 R503L probably benign Het
Anks1b C T 10: 90,897,327 probably benign Het
Anxa5 A T 3: 36,465,302 F13I probably damaging Het
Bicd1 A G 6: 149,484,005 I79V probably benign Het
Bnip1 A G 17: 26,789,745 D107G probably damaging Het
Ccdc42 A G 11: 68,588,220 E78G probably damaging Het
Ccnk A G 12: 108,187,187 D69G probably damaging Het
Clec2i G T 6: 128,893,729 V77F probably damaging Het
Clec4g A C 8: 3,718,803 V62G probably benign Het
Col4a4 G A 1: 82,487,583 A957V unknown Het
Csnk1d A G 11: 120,971,623 F277L probably damaging Het
Dip2c G A 13: 9,575,228 probably null Het
Dpf2 T A 19: 5,905,532 K108* probably null Het
Dync1h1 G A 12: 110,616,737 D423N probably damaging Het
Fbxl13 T C 5: 21,561,556 probably null Homo
Flad1 T C 3: 89,403,183 R488G probably damaging Het
Galnt6 A C 15: 100,693,355 *623E probably null Het
Gtf2e1 T C 16: 37,511,454 T420A possibly damaging Het
Hspg2 T C 4: 137,555,275 V3442A probably damaging Het
Itpr1 A G 6: 108,388,276 D55G probably damaging Het
Kdm2a C A 19: 4,324,826 R759L possibly damaging Het
Kif19a A G 11: 114,785,779 E478G probably damaging Het
Lamb3 G A 1: 193,335,453 V881I probably benign Het
Map3k6 T C 4: 133,250,024 L894P possibly damaging Het
Mast4 A G 13: 102,761,293 probably null Het
Mst1r G A 9: 107,913,239 V684M probably benign Het
Naa15 T C 3: 51,471,514 S727P probably damaging Het
Nap1l1 T C 10: 111,494,223 L330S probably damaging Het
Nav2 A G 7: 49,597,533 T2205A probably damaging Het
Ncf2 T C 1: 152,827,463 probably null Het
Olfr1199 T C 2: 88,756,108 D189G probably damaging Het
Olfr503 G A 7: 108,544,995 V155I probably benign Het
Olfr622 T C 7: 103,639,297 Y281C probably damaging Het
Pcdha7 T C 18: 36,973,942 Y7H possibly damaging Het
Pcdhb15 T C 18: 37,474,261 V182A probably benign Het
Phf10 A T 17: 14,956,007 I128N probably damaging Het
Plce1 T A 19: 38,748,521 probably null Het
Plxnb2 T C 15: 89,164,426 N626S probably benign Het
Prh1 G A 6: 132,572,033 G168R unknown Het
Prss51 A G 14: 64,097,406 T137A possibly damaging Het
Ptprcap C T 19: 4,156,184 R89C possibly damaging Het
Scfd1 A G 12: 51,431,541 K512R probably benign Het
Serpina1b A C 12: 103,735,037 probably null Het
Setbp1 T C 18: 78,857,390 T1021A probably damaging Het
Slco1b2 G A 6: 141,655,419 probably null Het
Snrnp200 C T 2: 127,221,827 T642I probably benign Het
Tenm4 A C 7: 96,843,044 I1063L possibly damaging Het
Tfb2m G A 1: 179,546,046 A29V probably benign Het
Tfeb T C 17: 47,789,702 V140A probably damaging Het
Tmem104 A T 11: 115,243,753 I372F probably damaging Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Trim12c A T 7: 104,348,324 N8K probably benign Het
Tti2 A G 8: 31,153,603 I249V probably null Het
Vps8 T A 16: 21,442,379 L90I probably damaging Het
Vwf A T 6: 125,662,963 probably null Het
Wdfy4 A G 14: 33,146,944 S376P probably damaging Het
Other mutations in Opa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Opa1 APN 16 29618115 splice site probably benign
IGL01087:Opa1 APN 16 29586997 missense probably damaging 1.00
IGL01799:Opa1 APN 16 29616658 missense possibly damaging 0.61
IGL01927:Opa1 APN 16 29586995 missense probably benign 0.35
IGL02067:Opa1 APN 16 29616655 missense probably damaging 1.00
IGL02317:Opa1 APN 16 29615166 critical splice donor site probably null
IGL02567:Opa1 APN 16 29588286 missense probably benign 0.01
IGL02826:Opa1 APN 16 29610887 missense probably null
Longshanks UTSW 16 29618259 missense probably damaging 1.00
R0032:Opa1 UTSW 16 29615069 missense probably damaging 1.00
R0032:Opa1 UTSW 16 29615069 missense probably damaging 1.00
R0092:Opa1 UTSW 16 29625594 missense probably damaging 0.99
R0114:Opa1 UTSW 16 29629635 missense probably benign 0.35
R0200:Opa1 UTSW 16 29614129 missense probably benign 0.08
R0308:Opa1 UTSW 16 29621531 missense probably damaging 0.98
R0427:Opa1 UTSW 16 29611461 missense probably damaging 0.98
R0671:Opa1 UTSW 16 29602207 splice site probably benign
R1768:Opa1 UTSW 16 29620810 missense probably benign
R1889:Opa1 UTSW 16 29625585 missense possibly damaging 0.67
R3932:Opa1 UTSW 16 29610880 missense probably damaging 1.00
R3933:Opa1 UTSW 16 29610880 missense probably damaging 1.00
R4434:Opa1 UTSW 16 29611983 missense probably damaging 1.00
R4618:Opa1 UTSW 16 29587039 missense probably damaging 1.00
R4926:Opa1 UTSW 16 29648973 missense possibly damaging 0.94
R5163:Opa1 UTSW 16 29597620 missense probably damaging 0.99
R5249:Opa1 UTSW 16 29618259 missense probably damaging 1.00
R5266:Opa1 UTSW 16 29618130 missense probably benign 0.19
R5275:Opa1 UTSW 16 29611579 missense probably damaging 1.00
R5372:Opa1 UTSW 16 29586119 missense probably benign 0.00
R5990:Opa1 UTSW 16 29587018 missense probably damaging 0.99
R6054:Opa1 UTSW 16 29615134 missense probably damaging 1.00
R6483:Opa1 UTSW 16 29628707 missense possibly damaging 0.72
R6889:Opa1 UTSW 16 29620868 missense probably benign 0.22
R7225:Opa1 UTSW 16 29614039 splice site probably null
R7243:Opa1 UTSW 16 29586996 missense probably benign 0.01
R7324:Opa1 UTSW 16 29586981 missense probably benign
R7831:Opa1 UTSW 16 29648937 missense probably benign 0.02
R7914:Opa1 UTSW 16 29648937 missense probably benign 0.02
R8304:Opa1 UTSW 16 29597671 missense possibly damaging 0.80
R8317:Opa1 UTSW 16 29614144 missense probably damaging 1.00
RF012:Opa1 UTSW 16 29613966 missense probably damaging 1.00
T0722:Opa1 UTSW 16 29610930 critical splice donor site probably null
X0065:Opa1 UTSW 16 29620784 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ACCAGTGGCTATGCTCCTAAG -3'
(R):5'- CACATCACCTTGTCCATGGTAC -3'

Sequencing Primer
(F):5'- GCTCCTAAGCCTCCTAGTTTATATC -3'
(R):5'- ATCACCTTGTCCATGGTACTTCTTG -3'
Posted On2018-06-06