Incidental Mutation 'R6522:Phf10'
List |< first << previous [record 38 of 58] next >> last >|
ID521426
Institutional Source Beutler Lab
Gene Symbol Phf10
Ensembl Gene ENSMUSG00000023883
Gene NamePHD finger protein 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6522 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location14945009-14961273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14956007 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 128 (I128N)
Ref Sequence ENSEMBL: ENSMUSP00000024657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024657] [ENSMUST00000168938]
Predicted Effect probably damaging
Transcript: ENSMUST00000024657
AA Change: I128N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000024657
Gene: ENSMUSG00000023883
AA Change: I128N

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 200 207 N/A INTRINSIC
low complexity region 281 310 N/A INTRINSIC
PHD 378 433 1.22e-8 SMART
PHD 434 478 2.44e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167805
Predicted Effect probably damaging
Transcript: ENSMUST00000168938
AA Change: I128N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125917
Gene: ENSMUSG00000023883
AA Change: I128N

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 200 207 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174163
Meta Mutation Damage Score 0.9133 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains a predicted ORF that encodes a protein with two zinc finger domains. The function of the encoded protein is not known. Sequence analysis suggests that multiple alternatively spliced transcript variants are derived from this gene but the full-length nature of only two of them is known. These two splice variants encode different isoforms. A pseudogene for this gene is located on Xq28. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a floxed allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C A 10: 10,377,892 E1209* probably null Het
Adgrg5 G T 8: 94,942,068 R503L probably benign Het
Anks1b C T 10: 90,897,327 probably benign Het
Anxa5 A T 3: 36,465,302 F13I probably damaging Het
Bicd1 A G 6: 149,484,005 I79V probably benign Het
Bnip1 A G 17: 26,789,745 D107G probably damaging Het
Ccdc42 A G 11: 68,588,220 E78G probably damaging Het
Ccnk A G 12: 108,187,187 D69G probably damaging Het
Clec2i G T 6: 128,893,729 V77F probably damaging Het
Clec4g A C 8: 3,718,803 V62G probably benign Het
Col4a4 G A 1: 82,487,583 A957V unknown Het
Csnk1d A G 11: 120,971,623 F277L probably damaging Het
Dip2c G A 13: 9,575,228 probably null Het
Dpf2 T A 19: 5,905,532 K108* probably null Het
Dync1h1 G A 12: 110,616,737 D423N probably damaging Het
Fbxl13 T C 5: 21,561,556 probably null Homo
Flad1 T C 3: 89,403,183 R488G probably damaging Het
Galnt6 A C 15: 100,693,355 *623E probably null Het
Gtf2e1 T C 16: 37,511,454 T420A possibly damaging Het
Hspg2 T C 4: 137,555,275 V3442A probably damaging Het
Itpr1 A G 6: 108,388,276 D55G probably damaging Het
Kdm2a C A 19: 4,324,826 R759L possibly damaging Het
Kif19a A G 11: 114,785,779 E478G probably damaging Het
Lamb3 G A 1: 193,335,453 V881I probably benign Het
Map3k6 T C 4: 133,250,024 L894P possibly damaging Het
Mast4 A G 13: 102,761,293 probably null Het
Mst1r G A 9: 107,913,239 V684M probably benign Het
Naa15 T C 3: 51,471,514 S727P probably damaging Het
Nap1l1 T C 10: 111,494,223 L330S probably damaging Het
Nav2 A G 7: 49,597,533 T2205A probably damaging Het
Ncf2 T C 1: 152,827,463 probably null Het
Olfr1199 T C 2: 88,756,108 D189G probably damaging Het
Olfr503 G A 7: 108,544,995 V155I probably benign Het
Olfr622 T C 7: 103,639,297 Y281C probably damaging Het
Opa1 T A 16: 29,625,514 N839K probably benign Het
Pcdha7 T C 18: 36,973,942 Y7H possibly damaging Het
Pcdhb15 T C 18: 37,474,261 V182A probably benign Het
Plce1 T A 19: 38,748,521 probably null Het
Plxnb2 T C 15: 89,164,426 N626S probably benign Het
Prh1 G A 6: 132,572,033 G168R unknown Het
Prss51 A G 14: 64,097,406 T137A possibly damaging Het
Ptprcap C T 19: 4,156,184 R89C possibly damaging Het
Scfd1 A G 12: 51,431,541 K512R probably benign Het
Serpina1b A C 12: 103,735,037 probably null Het
Setbp1 T C 18: 78,857,390 T1021A probably damaging Het
Slco1b2 G A 6: 141,655,419 probably null Het
Snrnp200 C T 2: 127,221,827 T642I probably benign Het
Tenm4 A C 7: 96,843,044 I1063L possibly damaging Het
Tfb2m G A 1: 179,546,046 A29V probably benign Het
Tfeb T C 17: 47,789,702 V140A probably damaging Het
Tmem104 A T 11: 115,243,753 I372F probably damaging Het
Tmem132d G T 5: 127,783,768 H1096Q probably benign Het
Trim12c A T 7: 104,348,324 N8K probably benign Het
Tti2 A G 8: 31,153,603 I249V probably null Het
Vps8 T A 16: 21,442,379 L90I probably damaging Het
Vwf A T 6: 125,662,963 probably null Het
Wdfy4 A G 14: 33,146,944 S376P probably damaging Het
Other mutations in Phf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01418:Phf10 APN 17 14945134 missense probably benign 0.01
IGL01752:Phf10 APN 17 14954950 splice site probably benign
IGL02048:Phf10 APN 17 14945149 missense probably benign 0.00
IGL02334:Phf10 APN 17 14954099 missense probably damaging 0.99
IGL03177:Phf10 APN 17 14946231 missense probably damaging 1.00
R1562:Phf10 UTSW 17 14946250 missense probably damaging 1.00
R1913:Phf10 UTSW 17 14956809 missense probably benign 0.00
R2159:Phf10 UTSW 17 14952664 missense probably damaging 0.99
R4468:Phf10 UTSW 17 14952775 critical splice acceptor site probably null
R4498:Phf10 UTSW 17 14945115 missense probably benign 0.17
R5357:Phf10 UTSW 17 14954013 critical splice donor site probably null
R5865:Phf10 UTSW 17 14955010 intron probably benign
R6105:Phf10 UTSW 17 14954125 critical splice acceptor site probably null
R6663:Phf10 UTSW 17 14959512 missense probably null 0.05
R7203:Phf10 UTSW 17 14946313 missense probably damaging 1.00
R8018:Phf10 UTSW 17 14954116 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GAATCTATGGGTTCAGTCCCC -3'
(R):5'- GCCATTCTTAATGAGCTGCCC -3'

Sequencing Primer
(F):5'- GGGTTCAGTCCCCAGTACTAC -3'
(R):5'- AGCTGCCCTAATGTAGTTAAGTGC -3'
Posted On2018-06-06