Incidental Mutation 'R6549:Vmn1r31'
ID 521435
Institutional Source Beutler Lab
Gene Symbol Vmn1r31
Ensembl Gene ENSMUSG00000115404
Gene Name vomeronasal 1 receptor 31
Synonyms Gm6709
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock # R6549 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 58470941-58475330 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58472663 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 72 (N72K)
Ref Sequence ENSEMBL: ENSMUSP00000153749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176023] [ENSMUST00000176147] [ENSMUST00000176177] [ENSMUST00000177318] [ENSMUST00000226390] [ENSMUST00000228586]
AlphaFold H3BKW5
Predicted Effect possibly damaging
Transcript: ENSMUST00000176023
AA Change: N23K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135252
Gene: ENSMUSG00000115404
AA Change: N23K

DomainStartEndE-ValueType
Pfam:V1R 1 58 1.9e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176147
AA Change: N23K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135282
Gene: ENSMUSG00000115404
AA Change: N23K

DomainStartEndE-ValueType
Pfam:V1R 1 58 1.9e-14 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000135472
Gene: ENSMUSG00000093379
AA Change: N72K

DomainStartEndE-ValueType
Pfam:V1R 28 293 4.7e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177318
AA Change: N72K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135555
Gene: ENSMUSG00000115404
AA Change: N72K

DomainStartEndE-ValueType
Pfam:V1R 28 107 1.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204999
Predicted Effect possibly damaging
Transcript: ENSMUST00000226390
AA Change: N72K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228586
AA Change: N72K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atm T C 9: 53,493,177 D1288G probably benign Het
Atxn7 T C 14: 14,013,087 S2P probably damaging Het
C1rl T A 6: 124,508,528 I286N probably benign Het
Ccdc54 T C 16: 50,590,025 R293G possibly damaging Het
Cndp1 A T 18: 84,636,184 I85K probably benign Het
Col25a1 A G 3: 130,182,795 T110A probably benign Het
Defb8 G T 8: 19,447,544 P17Q probably damaging Het
Dnah1 A T 14: 31,269,383 L3146Q probably damaging Het
Espn A T 4: 152,131,068 M1K probably null Het
Fam126b T C 1: 58,539,600 I264V probably benign Het
Gm9922 C A 14: 101,729,457 probably benign Het
Ldb3 A G 14: 34,541,897 M545T probably damaging Het
Olfr1076 A T 2: 86,509,382 I308L probably benign Het
Piezo1 G A 8: 122,500,263 H420Y Het
Primpol A T 8: 46,605,150 L115I probably damaging Het
Pus10 G A 11: 23,729,075 probably null Het
Rictor C G 15: 6,796,175 A1689G probably damaging Het
Scn2a A G 2: 65,764,674 N1956D probably benign Het
Scn4a T C 11: 106,343,965 D384G probably damaging Het
Sell A G 1: 164,065,629 D138G probably damaging Het
Slc4a7 T A 14: 14,748,564 F327L probably damaging Het
Sox6 A G 7: 115,486,692 I680T possibly damaging Het
Synj1 A G 16: 90,938,677 S1463P probably benign Het
Vmn2r77 A G 7: 86,800,857 I104V probably benign Het
Zfp988 G A 4: 147,331,853 C248Y probably benign Het
Other mutations in Vmn1r31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Vmn1r31 APN 6 58472799 missense probably benign 0.06
IGL01386:Vmn1r31 APN 6 58472602 missense probably benign 0.22
IGL01785:Vmn1r31 APN 6 58472724 missense possibly damaging 0.95
IGL02527:Vmn1r31 APN 6 58472793 missense probably benign 0.01
PIT4791001:Vmn1r31 UTSW 6 58472043 missense probably damaging 0.97
R0107:Vmn1r31 UTSW 6 58472743 missense probably benign 0.05
R1250:Vmn1r31 UTSW 6 58472658 missense probably benign 0.01
R1616:Vmn1r31 UTSW 6 58472058 missense probably damaging 0.97
R1883:Vmn1r31 UTSW 6 58472044 missense probably damaging 0.97
R1884:Vmn1r31 UTSW 6 58472044 missense probably damaging 0.97
R2942:Vmn1r31 UTSW 6 58472598 missense possibly damaging 0.87
R4589:Vmn1r31 UTSW 6 58472611 missense probably damaging 1.00
R4672:Vmn1r31 UTSW 6 58472071 missense probably damaging 0.97
R4676:Vmn1r31 UTSW 6 58472013 missense probably damaging 0.97
R4702:Vmn1r31 UTSW 6 58471968 makesense probably null
R4703:Vmn1r31 UTSW 6 58471968 makesense probably null
R4705:Vmn1r31 UTSW 6 58471968 makesense probably null
R6341:Vmn1r31 UTSW 6 58472010 missense probably benign 0.35
R7238:Vmn1r31 UTSW 6 58472873 missense
R7609:Vmn1r31 UTSW 6 58472470 missense probably damaging 0.97
R8438:Vmn1r31 UTSW 6 58472661 missense
R8936:Vmn1r31 UTSW 6 58472098 missense unknown
R9103:Vmn1r31 UTSW 6 58472088 missense unknown
Z1176:Vmn1r31 UTSW 6 58472391 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGAAGAACCGGTTACTACTGTAGG -3'
(R):5'- AAGCTGGACTTGGAGCCTTAG -3'

Sequencing Primer
(F):5'- CCGGTTACTACTGTAGGACAAATTG -3'
(R):5'- GACTTGGAGCCTTAGCCAATATG -3'
Posted On 2018-06-06