Mutagenetix > Incidental Mutations

Incidental Mutation 'R6522:Setbp1'

521436

Institutional Source

Beutler Lab

Gene Symbol

Setbp1

Ensembl Gene

ENSMUSG00000024548

Gene Name

SET binding protein 1

Synonyms

Seb

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.535) question?

Stock #

R6522 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78750380-79109391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 78857390 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1021 (T1021A)

Ref Sequence

ENSEMBL: ENSMUSP00000025430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025430]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025430
AA Change: T1021A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: T1021A

Domain	Start	End	E-Value	Type
low complexity region	155	165	N/A	INTRINSIC
low complexity region	221	251	N/A	INTRINSIC
low complexity region	278	286	N/A	INTRINSIC
AT_hook	528	540	4.64e-1	SMART
low complexity region	565	571	N/A	INTRINSIC
low complexity region	594	617	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC
AT_hook	960	972	1.89e-1	SMART
low complexity region	1086	1103	N/A	INTRINSIC
low complexity region	1316	1337	N/A	INTRINSIC
AT_hook	1393	1405	7.27e-1	SMART
low complexity region	1462	1486	N/A	INTRINSIC
low complexity region	1498	1514	N/A	INTRINSIC

Meta Mutation Damage Score

0.0620

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.3%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	C	A	10: 10,377,892	E1209*	probably null	Het
Adgrg5	G	T	8: 94,942,068	R503L	probably benign	Het
Anks1b	C	T	10: 90,897,327		probably benign	Het
Anxa5	A	T	3: 36,465,302	F13I	probably damaging	Het
Bicd1	A	G	6: 149,484,005	I79V	probably benign	Het
Bnip1	A	G	17: 26,789,745	D107G	probably damaging	Het
Ccdc42	A	G	11: 68,588,220	E78G	probably damaging	Het
Ccnk	A	G	12: 108,187,187	D69G	probably damaging	Het
Clec2i	G	T	6: 128,893,729	V77F	probably damaging	Het
Clec4g	A	C	8: 3,718,803	V62G	probably benign	Het
Col4a4	G	A	1: 82,487,583	A957V	unknown	Het
Csnk1d	A	G	11: 120,971,623	F277L	probably damaging	Het
Dip2c	G	A	13: 9,575,228		probably null	Het
Dpf2	T	A	19: 5,905,532	K108*	probably null	Het
Dync1h1	G	A	12: 110,616,737	D423N	probably damaging	Het
Fbxl13	T	C	5: 21,561,556		probably null	Homo
Flad1	T	C	3: 89,403,183	R488G	probably damaging	Het
Galnt6	A	C	15: 100,693,355	*623E	probably null	Het
Gtf2e1	T	C	16: 37,511,454	T420A	possibly damaging	Het
Hspg2	T	C	4: 137,555,275	V3442A	probably damaging	Het
Itpr1	A	G	6: 108,388,276	D55G	probably damaging	Het
Kdm2a	C	A	19: 4,324,826	R759L	possibly damaging	Het
Kif19a	A	G	11: 114,785,779	E478G	probably damaging	Het
Lamb3	G	A	1: 193,335,453	V881I	probably benign	Het
Map3k6	T	C	4: 133,250,024	L894P	possibly damaging	Het
Mast4	A	G	13: 102,761,293		probably null	Het
Mst1r	G	A	9: 107,913,239	V684M	probably benign	Het
Naa15	T	C	3: 51,471,514	S727P	probably damaging	Het
Nap1l1	T	C	10: 111,494,223	L330S	probably damaging	Het
Nav2	A	G	7: 49,597,533	T2205A	probably damaging	Het
Ncf2	T	C	1: 152,827,463		probably null	Het
Olfr1199	T	C	2: 88,756,108	D189G	probably damaging	Het
Olfr503	G	A	7: 108,544,995	V155I	probably benign	Het
Olfr622	T	C	7: 103,639,297	Y281C	probably damaging	Het
Opa1	T	A	16: 29,625,514	N839K	probably benign	Het
Pcdha7	T	C	18: 36,973,942	Y7H	possibly damaging	Het
Pcdhb15	T	C	18: 37,474,261	V182A	probably benign	Het
Phf10	A	T	17: 14,956,007	I128N	probably damaging	Het
Plce1	T	A	19: 38,748,521		probably null	Het
Plxnb2	T	C	15: 89,164,426	N626S	probably benign	Het
Prh1	G	A	6: 132,572,033	G168R	unknown	Het
Prss51	A	G	14: 64,097,406	T137A	possibly damaging	Het
Ptprcap	C	T	19: 4,156,184	R89C	possibly damaging	Het
Scfd1	A	G	12: 51,431,541	K512R	probably benign	Het
Serpina1b	A	C	12: 103,735,037		probably null	Het
Slco1b2	G	A	6: 141,655,419		probably null	Het
Snrnp200	C	T	2: 127,221,827	T642I	probably benign	Het
Tenm4	A	C	7: 96,843,044	I1063L	possibly damaging	Het
Tfb2m	G	A	1: 179,546,046	A29V	probably benign	Het
Tfeb	T	C	17: 47,789,702	V140A	probably damaging	Het
Tmem104	A	T	11: 115,243,753	I372F	probably damaging	Het
Tmem132d	G	T	5: 127,783,768	H1096Q	probably benign	Het
Trim12c	A	T	7: 104,348,324	N8K	probably benign	Het
Tti2	A	G	8: 31,153,603	I249V	probably null	Het
Vps8	T	A	16: 21,442,379	L90I	probably damaging	Het
Vwf	A	T	6: 125,662,963		probably null	Het
Wdfy4	A	G	14: 33,146,944	S376P	probably damaging	Het

Other mutations in Setbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Setbp1	APN	18	78755679	nonsense	probably null	0.00
IGL00668:Setbp1	APN	18	78857770	missense	probably damaging	1.00
IGL01628:Setbp1	APN	18	78856777	missense	probably damaging	1.00
IGL02084:Setbp1	APN	18	78857410	missense	probably damaging	1.00
IGL02405:Setbp1	APN	18	78857299	missense	probably damaging	1.00
IGL02427:Setbp1	APN	18	78857473	missense	probably damaging	1.00
IGL02612:Setbp1	APN	18	78755710	missense	probably damaging	1.00
IGL02725:Setbp1	APN	18	78857374	nonsense	probably null
IGL03005:Setbp1	APN	18	78859125	missense	possibly damaging	0.75
IGL03123:Setbp1	APN	18	78857009	missense	probably damaging	1.00
R1083:Setbp1	UTSW	18	78857626	missense	probably damaging	1.00
R1110:Setbp1	UTSW	18	78857860	missense	probably damaging	1.00
R1167:Setbp1	UTSW	18	78857236	missense	possibly damaging	0.85
R1221:Setbp1	UTSW	18	78856583	missense	probably damaging	1.00
R1225:Setbp1	UTSW	18	78858208	missense	probably damaging	0.99
R1327:Setbp1	UTSW	18	78783358	missense	probably benign	0.00
R1481:Setbp1	UTSW	18	78783301	missense	probably benign	0.01
R1482:Setbp1	UTSW	18	79086835	missense	probably damaging	1.00
R1496:Setbp1	UTSW	18	78859912	missense	probably damaging	1.00
R1550:Setbp1	UTSW	18	78858592	missense	probably damaging	1.00
R1708:Setbp1	UTSW	18	78858467	missense	probably damaging	0.99
R1751:Setbp1	UTSW	18	78857398	missense	probably damaging	1.00
R1922:Setbp1	UTSW	18	78858362	missense	possibly damaging	0.75
R1986:Setbp1	UTSW	18	78858544	missense	probably damaging	0.99
R2090:Setbp1	UTSW	18	78856720	missense	probably benign	0.00
R2851:Setbp1	UTSW	18	78923996	missense	probably benign	0.11
R2853:Setbp1	UTSW	18	78923996	missense	probably benign	0.11
R2941:Setbp1	UTSW	18	78858197	missense	probably damaging	1.00
R3151:Setbp1	UTSW	18	78857435	missense	probably damaging	1.00
R3156:Setbp1	UTSW	18	78859303	missense	probably benign	0.00
R3807:Setbp1	UTSW	18	78783322	missense	probably benign	0.01
R4133:Setbp1	UTSW	18	78856991	missense	probably benign	0.05
R4287:Setbp1	UTSW	18	78859061	missense	probably benign	0.03
R4345:Setbp1	UTSW	18	79086579	missense	probably damaging	0.99
R4374:Setbp1	UTSW	18	78859922	missense	probably damaging	0.97
R4377:Setbp1	UTSW	18	78859922	missense	probably damaging	0.97
R4378:Setbp1	UTSW	18	78856618	missense	possibly damaging	0.95
R4379:Setbp1	UTSW	18	79086681	missense	probably damaging	1.00
R4585:Setbp1	UTSW	18	79086949	missense	probably benign	0.00
R4595:Setbp1	UTSW	18	78857516	missense	probably benign	0.00
R4817:Setbp1	UTSW	18	78858800	missense	probably damaging	1.00
R4971:Setbp1	UTSW	18	78858167	missense	probably benign	0.07
R4976:Setbp1	UTSW	18	79086712	missense	probably damaging	1.00
R5017:Setbp1	UTSW	18	78856594	missense	possibly damaging	0.81
R5066:Setbp1	UTSW	18	78857299	missense	probably damaging	1.00
R5133:Setbp1	UTSW	18	78857482	missense	probably damaging	1.00
R5151:Setbp1	UTSW	18	78857999	missense	probably damaging	1.00
R5237:Setbp1	UTSW	18	78856975	missense	possibly damaging	0.92
R5480:Setbp1	UTSW	18	78858063	missense	probably damaging	0.99
R5507:Setbp1	UTSW	18	79086712	missense	probably damaging	1.00
R5529:Setbp1	UTSW	18	79086652	missense	probably damaging	0.99
R5622:Setbp1	UTSW	18	78857485	missense	probably damaging	1.00
R5722:Setbp1	UTSW	18	78856645	missense	possibly damaging	0.95
R5806:Setbp1	UTSW	18	78856482	unclassified	probably null
R5940:Setbp1	UTSW	18	78755488	missense	probably damaging	1.00
R6025:Setbp1	UTSW	18	78859240	missense	probably damaging	0.98
R6030:Setbp1	UTSW	18	78857711	missense	probably benign	0.02
R6030:Setbp1	UTSW	18	78857711	missense	probably benign	0.02
R6250:Setbp1	UTSW	18	78858002	missense	probably benign	0.00
R6256:Setbp1	UTSW	18	78857257	missense	probably damaging	1.00
R6332:Setbp1	UTSW	18	78783369	missense	probably benign	0.21
R6873:Setbp1	UTSW	18	78859559	missense	probably benign	0.00
R6886:Setbp1	UTSW	18	78857500	missense	probably damaging	1.00
R6986:Setbp1	UTSW	18	78857839	missense	probably damaging	1.00
R7042:Setbp1	UTSW	18	79086855	missense	probably damaging	1.00
R7131:Setbp1	UTSW	18	79086960	missense	probably benign	0.08
R7134:Setbp1	UTSW	18	78859519	missense	possibly damaging	0.86
R7215:Setbp1	UTSW	18	78856837	missense	probably damaging	0.97
R7219:Setbp1	UTSW	18	78755745	missense	probably damaging	1.00
R7378:Setbp1	UTSW	18	78857486	missense	probably damaging	1.00
R7461:Setbp1	UTSW	18	78856492	missense	probably benign	0.06
R7589:Setbp1	UTSW	18	78856492	missense	probably benign	0.01
R7840:Setbp1	UTSW	18	78783424	missense	probably benign	0.03
R7849:Setbp1	UTSW	18	78856853	missense	probably benign	0.00
R7923:Setbp1	UTSW	18	78783424	missense	probably benign	0.03
R7932:Setbp1	UTSW	18	78856853	missense	probably benign	0.00
Z1088:Setbp1	UTSW	18	78859594	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CATGAAAGGGGATGCTGCTC -3'
(R):5'- TCTGGCAGAGCTGGAAGAACTC -3'

Sequencing Primer
(F):5'- CTCCGAGTGTGTGTGACAGGTAC -3'
(R):5'- AAGTGTTCAGGATCTCCCACCG -3'

Posted On

2018-06-06