Incidental Mutation 'R6550:Cfap69'
ID521490
Institutional Source Beutler Lab
Gene Symbol Cfap69
Ensembl Gene ENSMUSG00000040473
Gene Namecilia and flagella associated protein 69
SynonymsA330021E22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6550 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location5579278-5664239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5581220 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 764 (D764E)
Ref Sequence ENSEMBL: ENSMUSP00000143393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054865] [ENSMUST00000148347] [ENSMUST00000155048] [ENSMUST00000196165]
Predicted Effect probably benign
Transcript: ENSMUST00000054865
AA Change: D935E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053206
Gene: ENSMUSG00000040473
AA Change: D935E

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 847 860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124734
AA Change: D162E
SMART Domains Protein: ENSMUSP00000119859
Gene: ENSMUSG00000040473
AA Change: D162E

DomainStartEndE-ValueType
low complexity region 75 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148347
AA Change: D471E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119944
Gene: ENSMUSG00000040473
AA Change: D471E

DomainStartEndE-ValueType
low complexity region 383 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155048
AA Change: D69E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000196165
AA Change: D764E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143393
Gene: ENSMUSG00000040473
AA Change: D764E

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 676 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199314
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 98% (39/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit faster response kinetics and stimuli integration to olfactory stimulation and impaired olfaction a buried food pellet test with a background of the same odor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apbb1ip A G 2: 22,858,233 D355G probably damaging Het
Asz1 T C 6: 18,051,381 D433G probably damaging Het
Atl3 A G 19: 7,522,138 T256A probably benign Het
Atp8b4 T A 2: 126,424,193 T183S probably damaging Het
Bahcc1 C T 11: 120,276,651 H1293Y possibly damaging Het
Bin2 A G 15: 100,645,477 V243A probably benign Het
Camta1 A C 4: 151,138,375 F908L probably damaging Het
Cbx2 T C 11: 119,029,025 V472A possibly damaging Het
Cd22 T C 7: 30,877,552 D110G probably benign Het
Col2a1 A G 15: 97,976,793 I1321T unknown Het
Cyp2c67 G T 19: 39,617,410 Y347* probably null Het
D630044L22Rik A T 17: 25,961,654 R66S possibly damaging Het
Defa27 A C 8: 21,316,324 R46S possibly damaging Het
E330034G19Rik A G 14: 24,296,818 M58V probably benign Het
Efhb G T 17: 53,421,940 H574N probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin1 A T 19: 44,037,163 probably null Het
Fam208b A G 13: 3,590,519 V206A possibly damaging Het
Gm10912 C T 2: 104,066,651 T45I possibly damaging Het
Gm906 G A 13: 50,245,446 P948L probably benign Het
Hsh2d C A 8: 72,198,453 T156K probably benign Het
Lrrc49 G T 9: 60,677,147 Q139K probably benign Het
Map3k21 A G 8: 125,937,292 S531G probably damaging Het
Marc2 C A 1: 184,819,342 R299L probably damaging Het
Mcm2 A G 6: 88,886,959 probably null Het
Myo9a T C 9: 59,868,199 F1031S probably damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr136 C T 17: 38,336,005 P283S possibly damaging Het
Pmfbp1 T C 8: 109,520,207 V237A possibly damaging Het
Polrmt C A 10: 79,739,680 Q672H probably damaging Het
Pp2d1 T C 17: 53,515,576 D154G probably damaging Het
Rars T C 11: 35,833,183 I57V probably benign Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Slc8b1 A G 5: 120,524,017 E257G probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem87b T A 2: 128,824,465 H77Q possibly damaging Het
Tpr C T 1: 150,423,977 L1200F probably damaging Het
Trir G T 8: 85,029,920 V154L probably damaging Het
Wdfy3 A G 5: 101,953,166 V195A probably benign Het
Zdhhc5 T C 2: 84,696,341 I96V probably benign Het
Other mutations in Cfap69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Cfap69 APN 5 5584682 missense probably damaging 1.00
IGL00234:Cfap69 APN 5 5617295 missense probably benign 0.03
IGL00658:Cfap69 APN 5 5625857 missense probably damaging 1.00
IGL00901:Cfap69 APN 5 5619162 splice site probably benign
IGL01410:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01415:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01839:Cfap69 APN 5 5626027 nonsense probably null
IGL01993:Cfap69 APN 5 5581284 missense probably damaging 0.99
IGL02821:Cfap69 APN 5 5664017 missense probably benign 0.01
IGL03212:Cfap69 APN 5 5657849 critical splice acceptor site probably null
IGL03339:Cfap69 APN 5 5586436 splice site probably benign
IGL03052:Cfap69 UTSW 5 5589206 missense probably damaging 0.97
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0387:Cfap69 UTSW 5 5589303 missense probably damaging 0.98
R0433:Cfap69 UTSW 5 5649853 missense probably damaging 0.99
R0690:Cfap69 UTSW 5 5663951 missense probably damaging 0.99
R0702:Cfap69 UTSW 5 5644465 missense probably benign 0.27
R0718:Cfap69 UTSW 5 5621924 missense probably damaging 1.00
R1525:Cfap69 UTSW 5 5640230 splice site probably null
R1670:Cfap69 UTSW 5 5586409 missense probably benign 0.27
R1677:Cfap69 UTSW 5 5582457 missense probably damaging 1.00
R1857:Cfap69 UTSW 5 5582518 missense possibly damaging 0.92
R1916:Cfap69 UTSW 5 5663970 missense probably damaging 0.99
R1937:Cfap69 UTSW 5 5593818 missense probably damaging 1.00
R2029:Cfap69 UTSW 5 5604306 missense probably damaging 1.00
R2106:Cfap69 UTSW 5 5595979 missense probably benign 0.05
R2177:Cfap69 UTSW 5 5625803 missense probably damaging 1.00
R2261:Cfap69 UTSW 5 5596018 missense probably damaging 0.99
R2939:Cfap69 UTSW 5 5644432 missense probably damaging 0.99
R3706:Cfap69 UTSW 5 5613843 nonsense probably null
R3876:Cfap69 UTSW 5 5584645 splice site probably benign
R3893:Cfap69 UTSW 5 5581245 missense probably damaging 1.00
R4033:Cfap69 UTSW 5 5604389 missense possibly damaging 0.87
R4760:Cfap69 UTSW 5 5646939 missense probably damaging 1.00
R4787:Cfap69 UTSW 5 5646934 critical splice donor site probably null
R4932:Cfap69 UTSW 5 5625820 missense probably damaging 1.00
R5215:Cfap69 UTSW 5 5589133 missense possibly damaging 0.82
R5258:Cfap69 UTSW 5 5604271 splice site probably null
R5596:Cfap69 UTSW 5 5626020 missense probably damaging 1.00
R5673:Cfap69 UTSW 5 5596027 missense possibly damaging 0.66
R5752:Cfap69 UTSW 5 5589204 missense probably damaging 1.00
R5933:Cfap69 UTSW 5 5640183 missense probably damaging 1.00
R6148:Cfap69 UTSW 5 5663996 missense probably benign 0.03
R6511:Cfap69 UTSW 5 5617220 missense probably damaging 0.98
R6870:Cfap69 UTSW 5 5621958 missense probably benign 0.26
R7455:Cfap69 UTSW 5 5625873 missense possibly damaging 0.92
R7544:Cfap69 UTSW 5 5595936 missense not run
R7547:Cfap69 UTSW 5 5604290 missense possibly damaging 0.88
R7787:Cfap69 UTSW 5 5589260 missense probably damaging 1.00
X0010:Cfap69 UTSW 5 5644503 splice site probably null
Z1177:Cfap69 UTSW 5 5586384 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCCCACAGAAATGTCCCTTAG -3'
(R):5'- GTGTGAAGACCTGTAGATATTTGTC -3'

Sequencing Primer
(F):5'- CCACAGAAATGTCCCTTAGGGTAG -3'
(R):5'- AAGACCTGTAGATATTTGTCTTTTCC -3'
Posted On2018-06-06