Incidental Mutation 'R6523:Themis'
ID521510
Institutional Source Beutler Lab
Gene Symbol Themis
Ensembl Gene ENSMUSG00000049109
Gene Namethymocyte selection associated
SynonymsTsepa, Gasp, E430004N04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6523 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location28668360-28883818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28781898 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 154 (T154I)
Ref Sequence ENSEMBL: ENSMUSP00000123894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056097] [ENSMUST00000060409] [ENSMUST00000105516] [ENSMUST00000159927] [ENSMUST00000161345]
Predicted Effect probably benign
Transcript: ENSMUST00000056097
AA Change: T307I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000060129
Gene: ENSMUSG00000049109
AA Change: T307I

DomainStartEndE-ValueType
Pfam:CABIT 17 266 5.2e-59 PFAM
Pfam:CABIT 282 530 3.7e-48 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060409
AA Change: T307I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000055315
Gene: ENSMUSG00000049109
AA Change: T307I

DomainStartEndE-ValueType
Pfam:CABIT 17 272 9.3e-52 PFAM
Pfam:CABIT 282 532 5e-62 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105516
AA Change: T307I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000101155
Gene: ENSMUSG00000049109
AA Change: T307I

DomainStartEndE-ValueType
Pfam:CABIT 17 272 9e-52 PFAM
Pfam:CABIT 282 532 4.9e-62 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159927
SMART Domains Protein: ENSMUSP00000123919
Gene: ENSMUSG00000049109

DomainStartEndE-ValueType
Pfam:CABIT 17 91 1.9e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161345
AA Change: T154I

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123894
Gene: ENSMUSG00000049109
AA Change: T154I

DomainStartEndE-ValueType
Pfam:CABIT 17 86 1.9e-9 PFAM
Pfam:CABIT 129 203 5.1e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: This gene encodes a protein that plays a regulatory role in both positive and negative T-cell selection during late thymocyte development. The protein functions through T-cell antigen receptor signaling, and is necessary for proper lineage commitment and maturation of T-cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous null mice have defects in T cell positive selection that leads to very few alpha-beta T cells being found in the periphery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,332,553 probably null Het
Alg2 A T 4: 47,472,071 S246T possibly damaging Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Arid4a A G 12: 71,067,341 probably null Het
AU040320 G A 4: 126,868,760 probably null Het
B430306N03Rik A G 17: 48,319,165 T129A possibly damaging Het
Blvrb C A 7: 27,465,717 probably null Het
Ccdc175 T C 12: 72,144,791 N337S probably benign Het
Ccdc28b A C 4: 129,620,987 F110V probably damaging Het
Cd200 A G 16: 45,400,270 Y16H probably benign Het
Cfh T G 1: 140,101,707 E950A possibly damaging Het
Clec3a A T 8: 114,425,605 Y117F probably damaging Het
CN725425 A G 15: 91,231,581 S9G probably benign Het
Coasy T A 11: 101,086,118 W535R probably damaging Het
Cox4i1 T A 8: 120,672,741 S30R probably benign Het
Csnk1a1 G A 18: 61,555,758 S3N probably benign Het
Dcst2 C G 3: 89,373,501 L669V probably benign Het
Ddx58 T A 4: 40,205,947 T882S probably benign Het
Dnah14 A G 1: 181,643,621 I1346V probably benign Het
Fbxw24 G A 9: 109,604,980 R421* probably null Het
Fstl5 G A 3: 76,536,334 V329I probably benign Het
Gli3 T C 13: 15,713,650 probably null Het
Gm13128 T C 4: 144,331,648 V275A probably benign Het
Gna11 A T 10: 81,544,854 I25N probably damaging Het
Greb1 C T 12: 16,684,373 V1539I possibly damaging Het
Hipk3 T A 2: 104,439,408 T479S possibly damaging Het
Hspa1b A G 17: 34,957,191 I606T probably benign Het
Idnk T A 13: 58,163,643 F141L probably damaging Het
Ifit3 A G 19: 34,588,155 N367S probably benign Het
Kcnn1 A T 8: 70,846,525 D448E possibly damaging Het
Krt14 T C 11: 100,205,097 T212A possibly damaging Het
Ldlr G A 9: 21,737,253 C285Y probably damaging Het
Mark3 G A 12: 111,627,235 V234I probably damaging Het
Meikin T A 11: 54,398,501 Y233* probably null Het
Muc20 T C 16: 32,793,450 D519G possibly damaging Het
Nalcn T A 14: 123,317,843 H876L probably benign Het
Ncaph A T 2: 127,105,889 I698K probably damaging Het
Nipal1 A T 5: 72,667,608 I215F probably damaging Het
Nrde2 A T 12: 100,134,405 D607E possibly damaging Het
Nt5dc2 T C 14: 31,135,705 F217S probably damaging Het
Ntsr2 T A 12: 16,656,696 S156T probably benign Het
Olfr1464-ps1 A C 19: 13,282,364 D231E probably benign Het
Olfr271-ps1 A T 4: 52,935,500 I261N probably damaging Het
Olfr481 A C 7: 108,081,555 T254P probably benign Het
Pfas A T 11: 68,990,457 I1028K probably benign Het
Pnpla5 C A 15: 84,115,711 R329L possibly damaging Het
Rhot2 A G 17: 25,839,420 V393A possibly damaging Het
Rnase9 T A 14: 51,039,227 Y98F possibly damaging Het
Sacs C A 14: 61,202,961 L819I probably damaging Het
Sall3 C T 18: 80,973,188 M508I possibly damaging Het
Scube3 G A 17: 28,162,388 C301Y probably damaging Het
Sgo2b G T 8: 63,927,504 H765N probably benign Het
Sh3gl1 A T 17: 56,017,617 Y344N possibly damaging Het
Slc15a2 A G 16: 36,752,321 V635A probably benign Het
Slc1a4 T A 11: 20,332,114 Y40F probably damaging Het
Slc4a10 A T 2: 62,286,961 K755* probably null Het
Slco1a5 C T 6: 142,266,395 G38R probably damaging Het
Snx25 T A 8: 46,055,855 D564V probably damaging Het
Soga1 G A 2: 157,060,343 Q251* probably null Het
Spon1 T A 7: 113,886,785 D189E probably benign Het
Sptbn5 T C 2: 120,065,614 probably null Het
Ssbp2 A G 13: 91,693,051 I317V probably benign Het
Stil AAGATTTCCAG A 4: 115,032,714 probably null Het
Strn3 A T 12: 51,643,098 probably null Het
Tcaf2 A T 6: 42,643,019 F25I probably benign Het
Ttn T C 2: 76,796,046 R13176G probably damaging Het
Utp4 G A 8: 106,898,463 V125M probably damaging Het
Vmn1r119 T A 7: 21,011,852 M202L possibly damaging Het
Zfp292 G C 4: 34,816,301 F329L probably benign Het
Zfp541 C T 7: 16,095,520 P1281L probably damaging Het
Zfp616 A T 11: 74,083,142 Q79L possibly damaging Het
Other mutations in Themis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Themis APN 10 28668753 splice site probably benign
IGL01729:Themis APN 10 28761591 nonsense probably null
IGL01833:Themis APN 10 28782311 nonsense probably null
IGL02582:Themis APN 10 28761547 missense probably benign 0.00
IGL02835:Themis APN 10 28761620 intron probably benign
cloudies UTSW 10 28761199 nonsense probably null
currant UTSW 10 28782011 missense probably damaging 1.00
death_valley UTSW 10 28668727 missense probably damaging 1.00
Meteor UTSW 10 28781832 missense possibly damaging 0.90
six_flags UTSW 10 28781907 missense probably damaging 1.00
R0445:Themis UTSW 10 28782011 missense probably damaging 1.00
R0507:Themis UTSW 10 28781832 missense possibly damaging 0.90
R0709:Themis UTSW 10 28761574 missense probably benign 0.00
R1170:Themis UTSW 10 28668748 missense possibly damaging 0.80
R1442:Themis UTSW 10 28782135 missense probably damaging 0.96
R1844:Themis UTSW 10 28781757 missense probably damaging 1.00
R2004:Themis UTSW 10 28782724 missense probably benign 0.28
R2150:Themis UTSW 10 28668727 missense probably damaging 1.00
R2358:Themis UTSW 10 28863380 missense possibly damaging 0.57
R4529:Themis UTSW 10 28782335 missense possibly damaging 0.92
R4693:Themis UTSW 10 28782651 missense probably damaging 1.00
R4717:Themis UTSW 10 28789752 missense probably benign
R4801:Themis UTSW 10 28761511 missense probably benign 0.21
R4802:Themis UTSW 10 28761511 missense probably benign 0.21
R5249:Themis UTSW 10 28761199 nonsense probably null
R5557:Themis UTSW 10 28781886 missense possibly damaging 0.90
R5569:Themis UTSW 10 28781891 missense possibly damaging 0.95
R5640:Themis UTSW 10 28863376 missense probably damaging 0.99
R5735:Themis UTSW 10 28722534 missense probably benign 0.09
R6467:Themis UTSW 10 28781766 missense possibly damaging 0.47
R6727:Themis UTSW 10 28781907 missense probably damaging 1.00
R7014:Themis UTSW 10 28789707 missense probably benign
R7101:Themis UTSW 10 28761426 nonsense probably null
R7185:Themis UTSW 10 28781877 missense probably benign 0.00
R7323:Themis UTSW 10 28733501 missense probably benign
R7386:Themis UTSW 10 28789747 missense probably benign 0.00
R7472:Themis UTSW 10 28761419 missense possibly damaging 0.69
R7555:Themis UTSW 10 28781702 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TAGTCCGGATTCTCCCAAGTTTAG -3'
(R):5'- ATGGAAAGCTTTGGTGGCC -3'

Sequencing Primer
(F):5'- CTCCCAAGTTTAGACGTTGAAGTC -3'
(R):5'- ACCACGTGGAGAGTTTCTTTC -3'
Posted On2018-06-06