Incidental Mutation 'R6550:Map3k21'
ID521517
Institutional Source Beutler Lab
Gene Symbol Map3k21
Ensembl Gene ENSMUSG00000031853
Gene Namemitogen-activated protein kinase kinase kinase 21
SynonymsBC021891
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.629) question?
Stock #R6550 (G1)
Quality Score182.009
Status Validated
Chromosome8
Chromosomal Location125910450-125947440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125937292 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 531 (S531G)
Ref Sequence ENSEMBL: ENSMUSP00000034316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034316]
Predicted Effect probably damaging
Transcript: ENSMUST00000034316
AA Change: S531G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034316
Gene: ENSMUSG00000031853
AA Change: S531G

DomainStartEndE-ValueType
SH3 27 87 1.1e-18 SMART
TyrKc 110 382 6.04e-82 SMART
coiled coil region 402 474 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
low complexity region 661 677 N/A INTRINSIC
low complexity region 740 758 N/A INTRINSIC
low complexity region 766 788 N/A INTRINSIC
Meta Mutation Damage Score 0.2426 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apbb1ip A G 2: 22,858,233 D355G probably damaging Het
Asz1 T C 6: 18,051,381 D433G probably damaging Het
Atl3 A G 19: 7,522,138 T256A probably benign Het
Atp8b4 T A 2: 126,424,193 T183S probably damaging Het
Bahcc1 C T 11: 120,276,651 H1293Y possibly damaging Het
Bin2 A G 15: 100,645,477 V243A probably benign Het
Camta1 A C 4: 151,138,375 F908L probably damaging Het
Cbx2 T C 11: 119,029,025 V472A possibly damaging Het
Cd22 T C 7: 30,877,552 D110G probably benign Het
Cfap69 A T 5: 5,581,220 D764E probably benign Het
Col2a1 A G 15: 97,976,793 I1321T unknown Het
Cyp2c67 G T 19: 39,617,410 Y347* probably null Het
D630044L22Rik A T 17: 25,961,654 R66S possibly damaging Het
Defa27 A C 8: 21,316,324 R46S possibly damaging Het
E330034G19Rik A G 14: 24,296,818 M58V probably benign Het
Efhb G T 17: 53,421,940 H574N probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin1 A T 19: 44,037,163 probably null Het
Fam208b A G 13: 3,590,519 V206A possibly damaging Het
Gm10912 C T 2: 104,066,651 T45I possibly damaging Het
Gm906 G A 13: 50,245,446 P948L probably benign Het
Hsh2d C A 8: 72,198,453 T156K probably benign Het
Lrrc49 G T 9: 60,677,147 Q139K probably benign Het
Marc2 C A 1: 184,819,342 R299L probably damaging Het
Mcm2 A G 6: 88,886,959 probably null Het
Myo9a T C 9: 59,868,199 F1031S probably damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr136 C T 17: 38,336,005 P283S possibly damaging Het
Pmfbp1 T C 8: 109,520,207 V237A possibly damaging Het
Polrmt C A 10: 79,739,680 Q672H probably damaging Het
Pp2d1 T C 17: 53,515,576 D154G probably damaging Het
Rars T C 11: 35,833,183 I57V probably benign Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Slc8b1 A G 5: 120,524,017 E257G probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem87b T A 2: 128,824,465 H77Q possibly damaging Het
Tpr C T 1: 150,423,977 L1200F probably damaging Het
Trir G T 8: 85,029,920 V154L probably damaging Het
Wdfy3 A G 5: 101,953,166 V195A probably benign Het
Zdhhc5 T C 2: 84,696,341 I96V probably benign Het
Other mutations in Map3k21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Map3k21 APN 8 125944673 missense possibly damaging 0.52
IGL01919:Map3k21 APN 8 125942132 missense probably damaging 0.97
IGL02065:Map3k21 APN 8 125941658 missense probably benign 0.01
IGL02123:Map3k21 APN 8 125926110 missense probably damaging 1.00
IGL02127:Map3k21 APN 8 125942147 missense probably benign
IGL02863:Map3k21 APN 8 125927541 missense probably benign 0.02
IGL03194:Map3k21 APN 8 125924062 missense possibly damaging 0.90
PIT4142001:Map3k21 UTSW 8 125937308 missense probably damaging 0.98
R0238:Map3k21 UTSW 8 125944970 missense possibly damaging 0.67
R0238:Map3k21 UTSW 8 125944970 missense possibly damaging 0.67
R0454:Map3k21 UTSW 8 125942119 missense probably benign
R0654:Map3k21 UTSW 8 125942020 missense probably benign 0.07
R1141:Map3k21 UTSW 8 125941732 missense probably benign 0.32
R1177:Map3k21 UTSW 8 125944838 missense probably benign 0.31
R1463:Map3k21 UTSW 8 125942137 missense probably benign 0.00
R1472:Map3k21 UTSW 8 125941678 missense probably benign
R1759:Map3k21 UTSW 8 125944780 missense probably benign
R1988:Map3k21 UTSW 8 125927555 missense probably benign 0.07
R2058:Map3k21 UTSW 8 125938722 missense probably benign 0.01
R2117:Map3k21 UTSW 8 125924042 missense probably benign 0.19
R2157:Map3k21 UTSW 8 125937266 missense probably benign
R2436:Map3k21 UTSW 8 125941615 nonsense probably null
R2507:Map3k21 UTSW 8 125939938 missense possibly damaging 0.73
R3125:Map3k21 UTSW 8 125941854 missense probably benign 0.26
R3746:Map3k21 UTSW 8 125935100 missense probably damaging 1.00
R4016:Map3k21 UTSW 8 125911185 missense probably damaging 1.00
R4647:Map3k21 UTSW 8 125942111 missense probably benign
R4648:Map3k21 UTSW 8 125942111 missense probably benign
R4864:Map3k21 UTSW 8 125927555 missense probably benign 0.04
R5642:Map3k21 UTSW 8 125938824 missense probably benign 0.17
R5694:Map3k21 UTSW 8 125944768 missense probably benign 0.04
R5950:Map3k21 UTSW 8 125941760 missense possibly damaging 0.93
R5982:Map3k21 UTSW 8 125911430 missense probably damaging 1.00
R6440:Map3k21 UTSW 8 125911137 missense probably damaging 1.00
R6664:Map3k21 UTSW 8 125941871 missense probably benign 0.01
R6668:Map3k21 UTSW 8 125926113 missense possibly damaging 0.60
R6788:Map3k21 UTSW 8 125939866 missense probably benign 0.28
R7369:Map3k21 UTSW 8 125911116 missense possibly damaging 0.86
R7371:Map3k21 UTSW 8 125935065 missense probably damaging 0.99
R7381:Map3k21 UTSW 8 125944978 missense possibly damaging 0.83
R7388:Map3k21 UTSW 8 125927597 missense probably damaging 1.00
R7397:Map3k21 UTSW 8 125935116 missense probably damaging 1.00
R7497:Map3k21 UTSW 8 125927601 missense probably damaging 0.99
R7562:Map3k21 UTSW 8 125938800 missense probably damaging 1.00
R7564:Map3k21 UTSW 8 125927708 critical splice donor site probably null
R7824:Map3k21 UTSW 8 125910963 missense probably benign 0.01
R8351:Map3k21 UTSW 8 125944733 missense probably benign 0.00
R8451:Map3k21 UTSW 8 125944733 missense probably benign 0.00
R8461:Map3k21 UTSW 8 125944622 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGACCTGAGTCTCTGAGAAGGG -3'
(R):5'- CCAAGGTTGGCTGTTCTTTC -3'

Sequencing Primer
(F):5'- CACATGCCTGAAAGAGTTGCTGTC -3'
(R):5'- CCAAGGTTGGCTGTTCTTTCTATGTC -3'
Posted On2018-06-06