Incidental Mutation 'R6550:Rars'
ID521525
Institutional Source Beutler Lab
Gene Symbol Rars
Ensembl Gene ENSMUSG00000018848
Gene Namearginyl-tRNA synthetase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6550 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location35808381-35834506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35833183 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 57 (I57V)
Ref Sequence ENSEMBL: ENSMUSP00000018992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018992]
Predicted Effect probably benign
Transcript: ENSMUST00000018992
AA Change: I57V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018992
Gene: ENSMUSG00000018848
AA Change: I57V

DomainStartEndE-ValueType
Blast:Arg_tRNA_synt_N 16 60 6e-13 BLAST
Arg_tRNA_synt_N 78 166 1.6e-27 SMART
Pfam:tRNA-synt_1d 174 520 1.2e-164 PFAM
DALR_1 534 660 3.12e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137815
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Arginyl-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apbb1ip A G 2: 22,858,233 D355G probably damaging Het
Asz1 T C 6: 18,051,381 D433G probably damaging Het
Atl3 A G 19: 7,522,138 T256A probably benign Het
Atp8b4 T A 2: 126,424,193 T183S probably damaging Het
Bahcc1 C T 11: 120,276,651 H1293Y possibly damaging Het
Bin2 A G 15: 100,645,477 V243A probably benign Het
Camta1 A C 4: 151,138,375 F908L probably damaging Het
Cbx2 T C 11: 119,029,025 V472A possibly damaging Het
Cd22 T C 7: 30,877,552 D110G probably benign Het
Cfap69 A T 5: 5,581,220 D764E probably benign Het
Col2a1 A G 15: 97,976,793 I1321T unknown Het
Cyp2c67 G T 19: 39,617,410 Y347* probably null Het
D630044L22Rik A T 17: 25,961,654 R66S possibly damaging Het
Defa27 A C 8: 21,316,324 R46S possibly damaging Het
E330034G19Rik A G 14: 24,296,818 M58V probably benign Het
Efhb G T 17: 53,421,940 H574N probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin1 A T 19: 44,037,163 probably null Het
Fam208b A G 13: 3,590,519 V206A possibly damaging Het
Gm10912 C T 2: 104,066,651 T45I possibly damaging Het
Gm906 G A 13: 50,245,446 P948L probably benign Het
Hsh2d C A 8: 72,198,453 T156K probably benign Het
Lrrc49 G T 9: 60,677,147 Q139K probably benign Het
Map3k21 A G 8: 125,937,292 S531G probably damaging Het
Marc2 C A 1: 184,819,342 R299L probably damaging Het
Mcm2 A G 6: 88,886,959 probably null Het
Myo9a T C 9: 59,868,199 F1031S probably damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr136 C T 17: 38,336,005 P283S possibly damaging Het
Pmfbp1 T C 8: 109,520,207 V237A possibly damaging Het
Polrmt C A 10: 79,739,680 Q672H probably damaging Het
Pp2d1 T C 17: 53,515,576 D154G probably damaging Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Slc8b1 A G 5: 120,524,017 E257G probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem87b T A 2: 128,824,465 H77Q possibly damaging Het
Tpr C T 1: 150,423,977 L1200F probably damaging Het
Trir G T 8: 85,029,920 V154L probably damaging Het
Wdfy3 A G 5: 101,953,166 V195A probably benign Het
Zdhhc5 T C 2: 84,696,341 I96V probably benign Het
Other mutations in Rars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Rars APN 11 35825981 splice site probably benign
IGL01672:Rars APN 11 35808553 missense probably damaging 0.99
IGL01721:Rars APN 11 35828664 missense probably damaging 1.00
IGL01887:Rars APN 11 35825995 missense probably benign 0.03
IGL02605:Rars APN 11 35824526 splice site probably benign
IGL03296:Rars APN 11 35816696 nonsense probably null
IGL03354:Rars APN 11 35824475 missense probably damaging 1.00
R0410:Rars UTSW 11 35826020 missense probably damaging 1.00
R1193:Rars UTSW 11 35809326 missense possibly damaging 0.92
R1222:Rars UTSW 11 35809740 missense probably damaging 1.00
R1418:Rars UTSW 11 35809740 missense probably damaging 1.00
R1562:Rars UTSW 11 35821094 critical splice donor site probably null
R1768:Rars UTSW 11 35809638 missense probably damaging 1.00
R1800:Rars UTSW 11 35825995 missense probably benign 0.03
R2055:Rars UTSW 11 35826583 splice site probably benign
R2294:Rars UTSW 11 35817536 splice site probably benign
R4281:Rars UTSW 11 35821224 missense probably damaging 1.00
R4807:Rars UTSW 11 35809146 missense possibly damaging 0.81
R4898:Rars UTSW 11 35808558 missense probably damaging 1.00
R5522:Rars UTSW 11 35817368 nonsense probably null
R5907:Rars UTSW 11 35828648 missense probably damaging 1.00
R6243:Rars UTSW 11 35826547 missense possibly damaging 0.64
R6289:Rars UTSW 11 35826067 missense probably damaging 1.00
R6889:Rars UTSW 11 35808486 missense probably damaging 1.00
R7260:Rars UTSW 11 35834454 missense probably benign 0.00
R7682:Rars UTSW 11 35828752 missense probably benign 0.00
R7808:Rars UTSW 11 35828707 missense probably benign
R7822:Rars UTSW 11 35819966 missense probably damaging 0.99
R7856:Rars UTSW 11 35808585 missense probably benign 0.09
R7939:Rars UTSW 11 35808585 missense probably benign 0.09
R8029:Rars UTSW 11 35821165 missense probably damaging 1.00
Z1177:Rars UTSW 11 35826109 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGCATGGACATAAGCCTTTG -3'
(R):5'- TCCGGGAAGCATTTGTTTGAC -3'

Sequencing Primer
(F):5'- CTACTTAAAAGGGCCCTGGG -3'
(R):5'- GACCTGGAAAAGTTGCCTTTC -3'
Posted On2018-06-06