Incidental Mutation 'R6550:Pp2d1'
ID521552
Institutional Source Beutler Lab
Gene Symbol Pp2d1
Ensembl Gene ENSMUSG00000044957
Gene Nameprotein phosphatase 2C-like domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6550 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location53507460-53539451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53515576 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 154 (D154G)
Ref Sequence ENSEMBL: ENSMUSP00000056682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056198]
Predicted Effect probably damaging
Transcript: ENSMUST00000056198
AA Change: D154G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056682
Gene: ENSMUSG00000044957
AA Change: D154G

DomainStartEndE-ValueType
PP2Cc 173 609 4.04e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apbb1ip A G 2: 22,858,233 D355G probably damaging Het
Asz1 T C 6: 18,051,381 D433G probably damaging Het
Atl3 A G 19: 7,522,138 T256A probably benign Het
Atp8b4 T A 2: 126,424,193 T183S probably damaging Het
Bahcc1 C T 11: 120,276,651 H1293Y possibly damaging Het
Bin2 A G 15: 100,645,477 V243A probably benign Het
Camta1 A C 4: 151,138,375 F908L probably damaging Het
Cbx2 T C 11: 119,029,025 V472A possibly damaging Het
Cd22 T C 7: 30,877,552 D110G probably benign Het
Cfap69 A T 5: 5,581,220 D764E probably benign Het
Col2a1 A G 15: 97,976,793 I1321T unknown Het
Cyp2c67 G T 19: 39,617,410 Y347* probably null Het
D630044L22Rik A T 17: 25,961,654 R66S possibly damaging Het
Defa27 A C 8: 21,316,324 R46S possibly damaging Het
E330034G19Rik A G 14: 24,296,818 M58V probably benign Het
Efhb G T 17: 53,421,940 H574N probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin1 A T 19: 44,037,163 probably null Het
Fam208b A G 13: 3,590,519 V206A possibly damaging Het
Gm10912 C T 2: 104,066,651 T45I possibly damaging Het
Gm906 G A 13: 50,245,446 P948L probably benign Het
Hsh2d C A 8: 72,198,453 T156K probably benign Het
Lrrc49 G T 9: 60,677,147 Q139K probably benign Het
Map3k21 A G 8: 125,937,292 S531G probably damaging Het
Marc2 C A 1: 184,819,342 R299L probably damaging Het
Mcm2 A G 6: 88,886,959 probably null Het
Myo9a T C 9: 59,868,199 F1031S probably damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr136 C T 17: 38,336,005 P283S possibly damaging Het
Pmfbp1 T C 8: 109,520,207 V237A possibly damaging Het
Polrmt C A 10: 79,739,680 Q672H probably damaging Het
Rars T C 11: 35,833,183 I57V probably benign Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Slc8b1 A G 5: 120,524,017 E257G probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem87b T A 2: 128,824,465 H77Q possibly damaging Het
Tpr C T 1: 150,423,977 L1200F probably damaging Het
Trir G T 8: 85,029,920 V154L probably damaging Het
Wdfy3 A G 5: 101,953,166 V195A probably benign Het
Zdhhc5 T C 2: 84,696,341 I96V probably benign Het
Other mutations in Pp2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Pp2d1 APN 17 53515639 missense probably benign 0.00
IGL01939:Pp2d1 APN 17 53515139 missense probably damaging 1.00
IGL02031:Pp2d1 APN 17 53508440 missense probably damaging 1.00
IGL02039:Pp2d1 APN 17 53515994 nonsense probably null
IGL02108:Pp2d1 APN 17 53515405 missense probably damaging 1.00
IGL02121:Pp2d1 APN 17 53507921 missense probably damaging 1.00
IGL03034:Pp2d1 APN 17 53508053 missense possibly damaging 0.88
R0483:Pp2d1 UTSW 17 53507971 missense probably benign 0.29
R0562:Pp2d1 UTSW 17 53539168 splice site probably benign
R1416:Pp2d1 UTSW 17 53515807 missense probably benign 0.07
R1464:Pp2d1 UTSW 17 53515987 missense possibly damaging 0.94
R1464:Pp2d1 UTSW 17 53515987 missense possibly damaging 0.94
R1479:Pp2d1 UTSW 17 53507855 missense probably benign 0.05
R1659:Pp2d1 UTSW 17 53515378 missense possibly damaging 0.50
R1711:Pp2d1 UTSW 17 53515310 missense possibly damaging 0.47
R2214:Pp2d1 UTSW 17 53515396 missense probably benign 0.01
R2217:Pp2d1 UTSW 17 53515454 missense probably benign 0.02
R2218:Pp2d1 UTSW 17 53515454 missense probably benign 0.02
R4463:Pp2d1 UTSW 17 53515858 missense probably benign
R4644:Pp2d1 UTSW 17 53515987 missense probably benign 0.00
R4901:Pp2d1 UTSW 17 53515009 missense probably benign 0.20
R5164:Pp2d1 UTSW 17 53508070 missense probably benign 0.11
R5169:Pp2d1 UTSW 17 53507902 missense possibly damaging 0.78
R5186:Pp2d1 UTSW 17 53508140 missense probably benign
R5223:Pp2d1 UTSW 17 53507845 missense probably benign 0.12
R6918:Pp2d1 UTSW 17 53515459 missense probably damaging 0.99
R7263:Pp2d1 UTSW 17 53515330 missense probably benign 0.00
R7623:Pp2d1 UTSW 17 53515879 missense probably benign 0.00
X0019:Pp2d1 UTSW 17 53515547 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CTTTGATGCCAGGTCTGCTG -3'
(R):5'- CACAATGCTCTGAGTATGCTG -3'

Sequencing Primer
(F):5'- TGCTGCATAACCGTAATGGC -3'
(R):5'- CAATGCTCTGAGTATGCTGGGTTTC -3'
Posted On2018-06-06