Incidental Mutation 'R6523:Muc20'
ID521556
Institutional Source Beutler Lab
Gene Symbol Muc20
Ensembl Gene ENSMUSG00000035638
Gene Namemucin 20
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6523 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location32777419-32797435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32793450 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 519 (D519G)
Ref Sequence ENSEMBL: ENSMUSP00000041221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041123] [ENSMUST00000115116]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041123
AA Change: D519G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041221
Gene: ENSMUSG00000035638
AA Change: D519G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
internal_repeat_1 114 146 3.3e-8 PROSPERO
internal_repeat_1 138 170 3.3e-8 PROSPERO
internal_repeat_2 144 161 5.26e-5 PROSPERO
low complexity region 171 204 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 228 245 5.26e-5 PROSPERO
low complexity region 324 351 N/A INTRINSIC
low complexity region 376 385 N/A INTRINSIC
low complexity region 516 550 N/A INTRINSIC
low complexity region 574 593 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115116
AA Change: D519G

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110769
Gene: ENSMUSG00000035638
AA Change: D519G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
internal_repeat_1 114 146 2.16e-8 PROSPERO
internal_repeat_1 138 170 2.16e-8 PROSPERO
internal_repeat_2 144 161 4e-5 PROSPERO
low complexity region 171 204 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 228 245 4e-5 PROSPERO
low complexity region 324 351 N/A INTRINSIC
low complexity region 376 385 N/A INTRINSIC
low complexity region 516 550 N/A INTRINSIC
low complexity region 574 593 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins secreted by many epithelial tissues to form an insoluble mucous barrier. The C-terminus of this family member associates with the multifunctional docking site of the MET proto-oncogene and suppresses activation of some downstream MET signaling cascades. The protein features a mucin tandem repeat domain that varies between two and six copies in most individuals. Multiple variants encoding different isoforms have been found for this gene. A related pseudogene, which is also located on chromosome 3, has been identified. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,332,553 probably null Het
Alg2 A T 4: 47,472,071 S246T possibly damaging Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Arid4a A G 12: 71,067,341 probably null Het
AU040320 G A 4: 126,868,760 probably null Het
B430306N03Rik A G 17: 48,319,165 T129A possibly damaging Het
Blvrb C A 7: 27,465,717 probably null Het
Ccdc175 T C 12: 72,144,791 N337S probably benign Het
Ccdc28b A C 4: 129,620,987 F110V probably damaging Het
Cd200 A G 16: 45,400,270 Y16H probably benign Het
Cfh T G 1: 140,101,707 E950A possibly damaging Het
Clec3a A T 8: 114,425,605 Y117F probably damaging Het
CN725425 A G 15: 91,231,581 S9G probably benign Het
Coasy T A 11: 101,086,118 W535R probably damaging Het
Cox4i1 T A 8: 120,672,741 S30R probably benign Het
Csnk1a1 G A 18: 61,555,758 S3N probably benign Het
Dcst2 C G 3: 89,373,501 L669V probably benign Het
Ddx58 T A 4: 40,205,947 T882S probably benign Het
Dnah14 A G 1: 181,643,621 I1346V probably benign Het
Fbxw24 G A 9: 109,604,980 R421* probably null Het
Fstl5 G A 3: 76,536,334 V329I probably benign Het
Gli3 T C 13: 15,713,650 probably null Het
Gm13128 T C 4: 144,331,648 V275A probably benign Het
Gna11 A T 10: 81,544,854 I25N probably damaging Het
Greb1 C T 12: 16,684,373 V1539I possibly damaging Het
Hipk3 T A 2: 104,439,408 T479S possibly damaging Het
Hspa1b A G 17: 34,957,191 I606T probably benign Het
Idnk T A 13: 58,163,643 F141L probably damaging Het
Ifit3 A G 19: 34,588,155 N367S probably benign Het
Kcnn1 A T 8: 70,846,525 D448E possibly damaging Het
Krt14 T C 11: 100,205,097 T212A possibly damaging Het
Ldlr G A 9: 21,737,253 C285Y probably damaging Het
Mark3 G A 12: 111,627,235 V234I probably damaging Het
Meikin T A 11: 54,398,501 Y233* probably null Het
Nalcn T A 14: 123,317,843 H876L probably benign Het
Ncaph A T 2: 127,105,889 I698K probably damaging Het
Nipal1 A T 5: 72,667,608 I215F probably damaging Het
Nrde2 A T 12: 100,134,405 D607E possibly damaging Het
Nt5dc2 T C 14: 31,135,705 F217S probably damaging Het
Ntsr2 T A 12: 16,656,696 S156T probably benign Het
Olfr1464-ps1 A C 19: 13,282,364 D231E probably benign Het
Olfr271-ps1 A T 4: 52,935,500 I261N probably damaging Het
Olfr481 A C 7: 108,081,555 T254P probably benign Het
Pfas A T 11: 68,990,457 I1028K probably benign Het
Pnpla5 C A 15: 84,115,711 R329L possibly damaging Het
Rhot2 A G 17: 25,839,420 V393A possibly damaging Het
Rnase9 T A 14: 51,039,227 Y98F possibly damaging Het
Sacs C A 14: 61,202,961 L819I probably damaging Het
Sall3 C T 18: 80,973,188 M508I possibly damaging Het
Scube3 G A 17: 28,162,388 C301Y probably damaging Het
Sgo2b G T 8: 63,927,504 H765N probably benign Het
Sh3gl1 A T 17: 56,017,617 Y344N possibly damaging Het
Slc15a2 A G 16: 36,752,321 V635A probably benign Het
Slc1a4 T A 11: 20,332,114 Y40F probably damaging Het
Slc4a10 A T 2: 62,286,961 K755* probably null Het
Slco1a5 C T 6: 142,266,395 G38R probably damaging Het
Snx25 T A 8: 46,055,855 D564V probably damaging Het
Soga1 G A 2: 157,060,343 Q251* probably null Het
Spon1 T A 7: 113,886,785 D189E probably benign Het
Sptbn5 T C 2: 120,065,614 probably null Het
Ssbp2 A G 13: 91,693,051 I317V probably benign Het
Stil AAGATTTCCAG A 4: 115,032,714 probably null Het
Strn3 A T 12: 51,643,098 probably null Het
Tcaf2 A T 6: 42,643,019 F25I probably benign Het
Themis C T 10: 28,781,898 T154I possibly damaging Het
Ttn T C 2: 76,796,046 R13176G probably damaging Het
Utp4 G A 8: 106,898,463 V125M probably damaging Het
Vmn1r119 T A 7: 21,011,852 M202L possibly damaging Het
Zfp292 G C 4: 34,816,301 F329L probably benign Het
Zfp541 C T 7: 16,095,520 P1281L probably damaging Het
Zfp616 A T 11: 74,083,142 Q79L possibly damaging Het
Other mutations in Muc20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Muc20 APN 16 32793703 missense probably benign 0.10
IGL02016:Muc20 APN 16 32797352 missense possibly damaging 0.46
IGL02092:Muc20 APN 16 32794272 missense probably damaging 0.99
IGL02415:Muc20 APN 16 32794681 missense unknown
R6669_muc20_072 UTSW 16 32793937 missense possibly damaging 0.94
R0552:Muc20 UTSW 16 32793930 missense probably damaging 0.98
R0629:Muc20 UTSW 16 32793421 missense possibly damaging 0.66
R0669:Muc20 UTSW 16 32794480 missense unknown
R0725:Muc20 UTSW 16 32793488 missense probably benign 0.05
R1676:Muc20 UTSW 16 32794279 missense probably damaging 1.00
R1771:Muc20 UTSW 16 32793852 missense probably damaging 0.97
R1778:Muc20 UTSW 16 32794141 missense possibly damaging 0.49
R1967:Muc20 UTSW 16 32794242 missense probably benign 0.03
R2104:Muc20 UTSW 16 32794177 missense probably damaging 0.99
R3054:Muc20 UTSW 16 32779029 missense probably benign 0.18
R4704:Muc20 UTSW 16 32779074 missense possibly damaging 0.70
R4893:Muc20 UTSW 16 32794672 missense possibly damaging 0.66
R4986:Muc20 UTSW 16 32777635 intron probably benign
R5191:Muc20 UTSW 16 32794476 missense unknown
R5195:Muc20 UTSW 16 32794476 missense unknown
R5875:Muc20 UTSW 16 32793819 missense possibly damaging 0.93
R5931:Muc20 UTSW 16 32794574 missense possibly damaging 0.81
R6434:Muc20 UTSW 16 32794806 missense probably benign 0.01
R6580:Muc20 UTSW 16 32793489 missense possibly damaging 0.77
R6669:Muc20 UTSW 16 32793937 missense possibly damaging 0.94
R7028:Muc20 UTSW 16 32794246 missense probably benign 0.03
R7681:Muc20 UTSW 16 32793619 missense probably benign 0.34
R7722:Muc20 UTSW 16 32797386 missense probably benign 0.00
W0251:Muc20 UTSW 16 32793853 missense possibly damaging 0.91
X0011:Muc20 UTSW 16 32793252 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GGTTTTCCTTATCCAAGCAGTGG -3'
(R):5'- CTCTGTTGGAACTTCGGTGAC -3'

Sequencing Primer
(F):5'- ATGCAGATGTTGTAGGATGCGTC -3'
(R):5'- CTTCGGTGACAGTTAGAAGGAACC -3'
Posted On2018-06-06