Incidental Mutation 'R6550:Cyp2c67'
ID521557
Institutional Source Beutler Lab
Gene Symbol Cyp2c67
Ensembl Gene ENSMUSG00000062624
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 67
SynonymsC730004C24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6550 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location39608842-39649051 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 39617410 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 347 (Y347*)
Ref Sequence ENSEMBL: ENSMUSP00000065796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067328]
Predicted Effect probably null
Transcript: ENSMUST00000067328
AA Change: Y347*
SMART Domains Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: Y347*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 8.5e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apbb1ip A G 2: 22,858,233 D355G probably damaging Het
Asz1 T C 6: 18,051,381 D433G probably damaging Het
Atl3 A G 19: 7,522,138 T256A probably benign Het
Atp8b4 T A 2: 126,424,193 T183S probably damaging Het
Bahcc1 C T 11: 120,276,651 H1293Y possibly damaging Het
Bin2 A G 15: 100,645,477 V243A probably benign Het
Camta1 A C 4: 151,138,375 F908L probably damaging Het
Cbx2 T C 11: 119,029,025 V472A possibly damaging Het
Cd22 T C 7: 30,877,552 D110G probably benign Het
Cfap69 A T 5: 5,581,220 D764E probably benign Het
Col2a1 A G 15: 97,976,793 I1321T unknown Het
D630044L22Rik A T 17: 25,961,654 R66S possibly damaging Het
Defa27 A C 8: 21,316,324 R46S possibly damaging Het
E330034G19Rik A G 14: 24,296,818 M58V probably benign Het
Efhb G T 17: 53,421,940 H574N probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin1 A T 19: 44,037,163 probably null Het
Fam208b A G 13: 3,590,519 V206A possibly damaging Het
Gm10912 C T 2: 104,066,651 T45I possibly damaging Het
Gm906 G A 13: 50,245,446 P948L probably benign Het
Hsh2d C A 8: 72,198,453 T156K probably benign Het
Lrrc49 G T 9: 60,677,147 Q139K probably benign Het
Map3k21 A G 8: 125,937,292 S531G probably damaging Het
Marc2 C A 1: 184,819,342 R299L probably damaging Het
Mcm2 A G 6: 88,886,959 probably null Het
Myo9a T C 9: 59,868,199 F1031S probably damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr136 C T 17: 38,336,005 P283S possibly damaging Het
Pmfbp1 T C 8: 109,520,207 V237A possibly damaging Het
Polrmt C A 10: 79,739,680 Q672H probably damaging Het
Pp2d1 T C 17: 53,515,576 D154G probably damaging Het
Rars T C 11: 35,833,183 I57V probably benign Het
Selplg G A 5: 113,820,149 P32L probably benign Het
Slc8b1 A G 5: 120,524,017 E257G probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem87b T A 2: 128,824,465 H77Q possibly damaging Het
Tpr C T 1: 150,423,977 L1200F probably damaging Het
Trir G T 8: 85,029,920 V154L probably damaging Het
Wdfy3 A G 5: 101,953,166 V195A probably benign Het
Zdhhc5 T C 2: 84,696,341 I96V probably benign Het
Other mutations in Cyp2c67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Cyp2c67 APN 19 39643385 missense possibly damaging 0.95
IGL01025:Cyp2c67 APN 19 39639932 nonsense probably null
IGL01363:Cyp2c67 APN 19 39639967 missense probably damaging 0.99
IGL01819:Cyp2c67 APN 19 39615721 missense probably damaging 0.98
IGL01902:Cyp2c67 APN 19 39649026 missense probably damaging 1.00
IGL02172:Cyp2c67 APN 19 39649002 missense possibly damaging 0.76
IGL02351:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02355:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02355:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02358:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02362:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02362:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02388:Cyp2c67 APN 19 39643355 missense probably benign 0.20
IGL03106:Cyp2c67 APN 19 39643675 missense probably benign 0.27
IGL03219:Cyp2c67 APN 19 39643294 missense possibly damaging 0.54
IGL03326:Cyp2c67 APN 19 39643269 critical splice donor site probably null
IGL03349:Cyp2c67 APN 19 39643684 missense probably damaging 1.00
IGL03356:Cyp2c67 APN 19 39639961 missense probably damaging 1.00
IGL03052:Cyp2c67 UTSW 19 39648885 missense possibly damaging 0.88
R0585:Cyp2c67 UTSW 19 39638694 missense possibly damaging 0.59
R0975:Cyp2c67 UTSW 19 39609178 missense possibly damaging 0.49
R0976:Cyp2c67 UTSW 19 39643374 missense probably damaging 1.00
R1252:Cyp2c67 UTSW 19 39626141 missense possibly damaging 0.93
R1398:Cyp2c67 UTSW 19 39638625 missense probably damaging 0.96
R1411:Cyp2c67 UTSW 19 39638591 missense probably damaging 1.00
R1505:Cyp2c67 UTSW 19 39648964 missense probably benign 0.00
R1543:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1613:Cyp2c67 UTSW 19 39626199 missense probably benign 0.00
R1618:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1667:Cyp2c67 UTSW 19 39643590 critical splice donor site probably null
R1852:Cyp2c67 UTSW 19 39617367 missense probably benign 0.01
R2005:Cyp2c67 UTSW 19 39643345 missense probably damaging 1.00
R2105:Cyp2c67 UTSW 19 39626237 missense probably benign 0.24
R2181:Cyp2c67 UTSW 19 39609097 missense possibly damaging 0.94
R3817:Cyp2c67 UTSW 19 39638683 missense probably benign 0.00
R4669:Cyp2c67 UTSW 19 39643654 missense probably benign 0.00
R4689:Cyp2c67 UTSW 19 39638588 missense probably benign 0.00
R4756:Cyp2c67 UTSW 19 39643744 missense probably benign 0.03
R4823:Cyp2c67 UTSW 19 39615724 missense probably benign 0.13
R5152:Cyp2c67 UTSW 19 39638688 missense probably benign 0.00
R5345:Cyp2c67 UTSW 19 39626232 missense probably benign 0.01
R5580:Cyp2c67 UTSW 19 39615650 missense probably damaging 0.99
R5644:Cyp2c67 UTSW 19 39615694 missense possibly damaging 0.84
R6116:Cyp2c67 UTSW 19 39617435 missense probably damaging 1.00
R6516:Cyp2c67 UTSW 19 39617429 missense probably damaging 1.00
R6939:Cyp2c67 UTSW 19 39643334 missense possibly damaging 0.68
R6995:Cyp2c67 UTSW 19 39615679 missense probably damaging 0.96
R7028:Cyp2c67 UTSW 19 39639897 missense possibly damaging 0.68
R7144:Cyp2c67 UTSW 19 39615694 missense probably benign 0.00
R7242:Cyp2c67 UTSW 19 39617339 missense probably benign 0.30
R7335:Cyp2c67 UTSW 19 39640007 nonsense probably null
R7337:Cyp2c67 UTSW 19 39609264 splice site probably null
R7474:Cyp2c67 UTSW 19 39617432 missense probably null 0.05
R7642:Cyp2c67 UTSW 19 39615640 missense probably damaging 0.97
R7870:Cyp2c67 UTSW 19 39609225 missense probably damaging 1.00
R8152:Cyp2c67 UTSW 19 39640008 missense probably benign 0.21
R8367:Cyp2c67 UTSW 19 39638674 missense probably benign 0.01
Z1177:Cyp2c67 UTSW 19 39643679 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGCTTCTTTCTCAGTGGTGAAC -3'
(R):5'- CCACTTTCTTCATGGCCTAGGTAG -3'

Sequencing Primer
(F):5'- TGGAGAGGACTGGAATCACACTG -3'
(R):5'- CATGGCCTAGGTAGCTGTGC -3'
Posted On2018-06-06