Incidental Mutation 'R6551:Cryge'
ID521563
Institutional Source Beutler Lab
Gene Symbol Cryge
Ensembl Gene ENSMUSG00000070870
Gene Namecrystallin, gamma E
SynonymsCryg-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6551 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location65048554-65051149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65048637 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 171 (M171K)
Ref Sequence ENSEMBL: ENSMUSP00000084617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087359] [ENSMUST00000161960]
Predicted Effect probably benign
Transcript: ENSMUST00000087359
AA Change: M171K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000084617
Gene: ENSMUSG00000070870
AA Change: M171K

DomainStartEndE-ValueType
XTALbg 3 82 3.46e-45 SMART
XTALbg 89 170 5.4e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161960
SMART Domains Protein: ENSMUSP00000124711
Gene: ENSMUSG00000070870

DomainStartEndE-ValueType
low complexity region 35 73 N/A INTRINSIC
low complexity region 121 130 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mutations in this gene produce severe, nuclear and zonular cataracts with microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A T 1: 193,174,523 Q61L probably damaging Het
Acss2 T C 2: 155,551,208 S285P probably benign Het
Ager A G 17: 34,599,468 probably null Het
Alkbh7 T A 17: 56,998,945 Y115* probably null Het
Brwd1 T C 16: 95,993,962 D2184G possibly damaging Het
Chp1 T A 2: 119,571,813 H89Q possibly damaging Het
Clmp T C 9: 40,771,277 V119A probably benign Het
Cttnbp2nl A T 3: 105,005,117 S484T possibly damaging Het
Dsg3 C A 18: 20,539,911 P880T unknown Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Espn T C 4: 152,128,766 Het
Fbxo31 A C 8: 121,564,704 probably benign Het
Grin2b A G 6: 135,733,344 V1068A probably damaging Het
Jak1 C A 4: 101,193,843 probably benign Het
Klra10 A T 6: 130,275,755 D185E probably benign Het
Lhx1 A C 11: 84,521,913 D60E probably benign Het
Lyar C A 5: 38,233,272 A326D probably damaging Het
Muc16 A C 9: 18,562,562 S1280A possibly damaging Het
Nol9 G A 4: 152,051,868 V466I possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1120 T C 2: 87,846,661 V130A possibly damaging Het
Olfr1380 G T 11: 49,563,989 V23L probably benign Het
Olfr23 T C 11: 73,940,303 I19T probably benign Het
Olfr317 A T 11: 58,732,757 M136K probably damaging Het
Olfr959 C A 9: 39,572,560 R233L probably benign Het
Pik3c2a A T 7: 116,417,496 I342N probably damaging Het
Pnldc1 A G 17: 12,905,569 M133T probably damaging Het
Rab11fip1 G A 8: 27,156,484 S188L probably damaging Het
Rapgef2 A T 3: 79,215,035 probably null Het
Rnf103 G A 6: 71,510,365 C660Y probably damaging Het
Rph3al G A 11: 75,906,546 S108F possibly damaging Het
Srsf7 A C 17: 80,204,219 probably benign Het
Ssrp1 A G 2: 85,041,106 probably null Het
Tamm41 T C 6: 115,012,181 D284G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem39b A G 4: 129,692,103 V25A probably benign Het
Tmem88b G T 4: 155,785,692 probably benign Het
Unk T C 11: 116,050,724 W266R probably damaging Het
Usp8 T A 2: 126,733,182 probably benign Het
Zbtb48 T G 4: 152,022,221 Q142P probably benign Het
Zdhhc18 T C 4: 133,613,649 T267A probably benign Het
Zfp335 G A 2: 164,909,365 P94S probably benign Het
Other mutations in Cryge
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Cryge APN 1 65048698 missense probably damaging 1.00
R1023:Cryge UTSW 1 65050786 missense probably damaging 1.00
R1159:Cryge UTSW 1 65050808 missense probably benign 0.00
R1463:Cryge UTSW 1 65048838 nonsense probably null
R4850:Cryge UTSW 1 65051052 intron probably benign
R4851:Cryge UTSW 1 65051052 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCCCACCCCTATGTATGATAC -3'
(R):5'- TCTACGAGCGAGAGGACTAC -3'

Sequencing Primer
(F):5'- GCCCACCCCTATGTATGATACTATCC -3'
(R):5'- TGGAGATCACAGACGACTGCTC -3'
Posted On2018-06-06