Incidental Mutation 'R6551:Olfr1120'
ID521571
Institutional Source Beutler Lab
Gene Symbol Olfr1120
Ensembl Gene ENSMUSG00000081234
Gene Nameolfactory receptor 1120
SynonymsMOR264-2, GA_x6K02T2Q125-48849180-48850100
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R6551 (G1)
Quality Score147.008
Status Validated
Chromosome2
Chromosomal Location87354815-87361786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87846661 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 130 (V130A)
Ref Sequence ENSEMBL: ENSMUSP00000150363 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000121186
AA Change: V130A

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1546 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A T 1: 193,174,523 Q61L probably damaging Het
Acss2 T C 2: 155,551,208 S285P probably benign Het
Ager A G 17: 34,599,468 probably null Het
Alkbh7 T A 17: 56,998,945 Y115* probably null Het
Brwd1 T C 16: 95,993,962 D2184G possibly damaging Het
Chp1 T A 2: 119,571,813 H89Q possibly damaging Het
Clmp T C 9: 40,771,277 V119A probably benign Het
Cryge A T 1: 65,048,637 M171K probably benign Het
Cttnbp2nl A T 3: 105,005,117 S484T possibly damaging Het
Dsg3 C A 18: 20,539,911 P880T unknown Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Espn T C 4: 152,128,766 Het
Fbxo31 A C 8: 121,564,704 probably benign Het
Grin2b A G 6: 135,733,344 V1068A probably damaging Het
Jak1 C A 4: 101,193,843 probably benign Het
Klra10 A T 6: 130,275,755 D185E probably benign Het
Lhx1 A C 11: 84,521,913 D60E probably benign Het
Lyar C A 5: 38,233,272 A326D probably damaging Het
Muc16 A C 9: 18,562,562 S1280A possibly damaging Het
Nol9 G A 4: 152,051,868 V466I possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1380 G T 11: 49,563,989 V23L probably benign Het
Olfr23 T C 11: 73,940,303 I19T probably benign Het
Olfr317 A T 11: 58,732,757 M136K probably damaging Het
Olfr959 C A 9: 39,572,560 R233L probably benign Het
Pik3c2a A T 7: 116,417,496 I342N probably damaging Het
Pnldc1 A G 17: 12,905,569 M133T probably damaging Het
Rab11fip1 G A 8: 27,156,484 S188L probably damaging Het
Rapgef2 A T 3: 79,215,035 probably null Het
Rnf103 G A 6: 71,510,365 C660Y probably damaging Het
Rph3al G A 11: 75,906,546 S108F possibly damaging Het
Srsf7 A C 17: 80,204,219 probably benign Het
Ssrp1 A G 2: 85,041,106 probably null Het
Tamm41 T C 6: 115,012,181 D284G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem39b A G 4: 129,692,103 V25A probably benign Het
Tmem88b G T 4: 155,785,692 probably benign Het
Unk T C 11: 116,050,724 W266R probably damaging Het
Usp8 T A 2: 126,733,182 probably benign Het
Zbtb48 T G 4: 152,022,221 Q142P probably benign Het
Zdhhc18 T C 4: 133,613,649 T267A probably benign Het
Zfp335 G A 2: 164,909,365 P94S probably benign Het
Other mutations in Olfr1120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Olfr1120 APN 2 87357545 missense possibly damaging 0.82
IGL01680:Olfr1120 APN 2 87357905 missense probably damaging 1.00
IGL02210:Olfr1120 APN 2 87358003 missense probably damaging 1.00
R0624:Olfr1120 UTSW 2 87357682 nonsense probably null
R0849:Olfr1120 UTSW 2 87358265 missense probably benign 0.00
R1298:Olfr1120 UTSW 2 87358070 missense probably benign 0.20
R2309:Olfr1120 UTSW 2 87357954 missense probably damaging 1.00
R4237:Olfr1120 UTSW 2 87358253 missense probably damaging 1.00
R4291:Olfr1120 UTSW 2 87358075 missense probably benign 0.00
R5679:Olfr1120 UTSW 2 87357545 missense possibly damaging 0.82
R5939:Olfr1120 UTSW 2 87357704 missense possibly damaging 0.55
R6269:Olfr1120 UTSW 2 87846874 missense possibly damaging 0.65
R7024:Olfr1120 UTSW 2 87357722 missense probably benign 0.06
R7242:Olfr1120 UTSW 2 87358082 missense probably benign 0.13
R7359:Olfr1120 UTSW 2 87358211 missense possibly damaging 0.77
R7444:Olfr1120 UTSW 2 87358100 missense possibly damaging 0.94
R7488:Olfr1120 UTSW 2 87358253 missense probably damaging 1.00
R7646:Olfr1120 UTSW 2 87357758 missense probably benign 0.00
R7711:Olfr1120 UTSW 2 87357527 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCAGTATGGACCAAGCATTACAG -3'
(R):5'- TGGTATGTCACAGAAGAAGTGGTTG -3'

Sequencing Primer
(F):5'- GTATGGACCAAGCATTACAGAAACC -3'
(R):5'- TCACAGAAGAAGTGGTTGATTTTG -3'
Posted On2018-06-06