Incidental Mutation 'R6524:Vmn2r23'
ID 521592
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R6524 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 123702821-123742291 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 123713425 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 420 (L420Q)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably damaging
Transcript: ENSMUST00000172391
AA Change: L420Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: L420Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,009 R100G possibly damaging Het
Acin1 G T 14: 54,645,283 D237E probably damaging Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
C3 A T 17: 57,217,264 probably null Het
Dnaaf2 A T 12: 69,190,385 C650S probably benign Het
Dsg2 T G 18: 20,583,036 F315V probably damaging Het
Dyrk1a C T 16: 94,685,120 S404L probably benign Het
Eefsec T C 6: 88,297,920 probably null Het
Esco1 T G 18: 10,582,188 probably null Het
Fam83a T C 15: 57,995,340 probably null Het
Fat3 A T 9: 15,992,256 V2981E probably damaging Het
Gm6970 G A 19: 47,170,560 T192M unknown Het
Heatr5b A G 17: 78,814,106 L730P possibly damaging Het
Hgsnat A G 8: 25,945,232 S625P probably damaging Het
Itpr1 C T 6: 108,363,683 T84I probably damaging Het
Itpr2 T C 6: 146,345,211 N1070S probably benign Het
Itsn1 T C 16: 91,911,995 F276L probably damaging Het
Krt84 A G 15: 101,532,752 S2P unknown Het
Lbhd2 G A 12: 111,410,290 R57H probably damaging Het
Lcmt2 T C 2: 121,138,931 E337G possibly damaging Het
Lrp1b T C 2: 40,851,804 E3037G possibly damaging Het
Lrp2 T C 2: 69,436,639 E4308G possibly damaging Het
Med13 A G 11: 86,301,467 I824T probably damaging Het
Meiob G A 17: 24,832,517 V291I probably benign Het
Mtcl1 A T 17: 66,348,285 D1343E probably benign Het
Mybl2 C A 2: 163,074,530 P367Q possibly damaging Het
Nav3 T C 10: 109,720,030 N1680S probably damaging Het
Nif3l1 T C 1: 58,457,840 V308A probably benign Het
Olfr191 C T 16: 59,086,277 V69M possibly damaging Het
Pclo G A 5: 14,718,869 R4366H unknown Het
Phax T A 18: 56,587,002 D338E probably damaging Het
Pnpla6 T A 8: 3,534,519 probably null Het
Rint1 A T 5: 23,815,739 M529L probably benign Het
Scand1 C T 2: 156,312,249 probably benign Het
Six3 C T 17: 85,621,970 T244I probably damaging Het
Slc4a4 T C 5: 89,232,764 S1034P probably benign Het
Ssu72 T G 4: 155,715,540 N53K probably null Het
Timm44 T C 8: 4,267,988 D140G possibly damaging Het
Tspan8 T C 10: 115,844,079 F200L probably benign Het
Tyw5 A T 1: 57,388,731 V234D possibly damaging Het
Ubxn10 T A 4: 138,720,883 R161* probably null Het
Wdr1 A T 5: 38,530,063 D208E probably benign Het
Yif1a A G 19: 5,092,176 Y230C probably damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123704541 missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123741353 missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123704640 missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123741656 missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123713472 missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123703032 missense
R8966:Vmn2r23 UTSW 6 123742120 missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123742079 missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123741823 missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123712713 missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123712713 missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123713116 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTTTATCCAGGATGTGTGGTCCATC -3'
(R):5'- AATACTTTGAGGAAGGAGACAGTACTC -3'

Sequencing Primer
(F):5'- GTGGTCCATCTTATTTGAATGTCC -3'
(R):5'- GGAGACAGTACTCTAAAGAACTATGC -3'
Posted On 2018-06-06