Incidental Mutation 'R6551:Rab11fip1'
ID521622
Institutional Source Beutler Lab
Gene Symbol Rab11fip1
Ensembl Gene ENSMUSG00000031488
Gene NameRAB11 family interacting protein 1 (class I)
Synonyms4833414G05Rik, 2010200K21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6551 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location27138773-27174646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27156484 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 188 (S188L)
Ref Sequence ENSEMBL: ENSMUSP00000058042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033878] [ENSMUST00000054212] [ENSMUST00000209377]
Predicted Effect probably benign
Transcript: ENSMUST00000033878
AA Change: S188L

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000033878
Gene: ENSMUSG00000031488
AA Change: S188L

DomainStartEndE-ValueType
C2 19 125 1.57e-13 SMART
low complexity region 173 185 N/A INTRINSIC
low complexity region 201 227 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 373 396 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
Pfam:RBD-FIP 588 635 6.1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054212
AA Change: S188L

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058042
Gene: ENSMUSG00000031488
AA Change: S188L

DomainStartEndE-ValueType
C2 19 125 1.57e-13 SMART
low complexity region 173 185 N/A INTRINSIC
low complexity region 201 227 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 373 396 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
low complexity region 582 600 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 745 757 N/A INTRINSIC
low complexity region 882 893 N/A INTRINSIC
low complexity region 976 983 N/A INTRINSIC
low complexity region 992 999 N/A INTRINSIC
Pfam:RBD-FIP 1109 1156 3.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209377
AA Change: S188L

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211028
Meta Mutation Damage Score 0.0835 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the Rab11-family interacting proteins (Rab11-FIPs), which play a role in the Rab-11 mediated recycling of vesicles. The encoded protein may be involved in endocytic sorting, trafficking of proteins including integrin subunits and epidermal growth factor receptor (EGFR), and transport between the recycling endosome and the trans-Golgi network. Alternative splicing results in multiple transcript variants. A pseudogene is described on the X chromosome. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous knockout results in reduced metastatic potential of pancreatic adenocarcinoma (PDAC) tumor cells in KPC (PDAC model) mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A T 1: 193,174,523 Q61L probably damaging Het
Acss2 T C 2: 155,551,208 S285P probably benign Het
Ager A G 17: 34,599,468 probably null Het
Alkbh7 T A 17: 56,998,945 Y115* probably null Het
Brwd1 T C 16: 95,993,962 D2184G possibly damaging Het
Chp1 T A 2: 119,571,813 H89Q possibly damaging Het
Clmp T C 9: 40,771,277 V119A probably benign Het
Cryge A T 1: 65,048,637 M171K probably benign Het
Cttnbp2nl A T 3: 105,005,117 S484T possibly damaging Het
Dsg3 C A 18: 20,539,911 P880T unknown Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Espn T C 4: 152,128,766 Het
Fbxo31 A C 8: 121,564,704 probably benign Het
Grin2b A G 6: 135,733,344 V1068A probably damaging Het
Jak1 C A 4: 101,193,843 probably benign Het
Klra10 A T 6: 130,275,755 D185E probably benign Het
Lhx1 A C 11: 84,521,913 D60E probably benign Het
Lyar C A 5: 38,233,272 A326D probably damaging Het
Muc16 A C 9: 18,562,562 S1280A possibly damaging Het
Nol9 G A 4: 152,051,868 V466I possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1120 T C 2: 87,846,661 V130A possibly damaging Het
Olfr1380 G T 11: 49,563,989 V23L probably benign Het
Olfr23 T C 11: 73,940,303 I19T probably benign Het
Olfr317 A T 11: 58,732,757 M136K probably damaging Het
Olfr959 C A 9: 39,572,560 R233L probably benign Het
Pik3c2a A T 7: 116,417,496 I342N probably damaging Het
Pnldc1 A G 17: 12,905,569 M133T probably damaging Het
Rapgef2 A T 3: 79,215,035 probably null Het
Rnf103 G A 6: 71,510,365 C660Y probably damaging Het
Rph3al G A 11: 75,906,546 S108F possibly damaging Het
Srsf7 A C 17: 80,204,219 probably benign Het
Ssrp1 A G 2: 85,041,106 probably null Het
Tamm41 T C 6: 115,012,181 D284G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem39b A G 4: 129,692,103 V25A probably benign Het
Tmem88b G T 4: 155,785,692 probably benign Het
Unk T C 11: 116,050,724 W266R probably damaging Het
Usp8 T A 2: 126,733,182 probably benign Het
Zbtb48 T G 4: 152,022,221 Q142P probably benign Het
Zdhhc18 T C 4: 133,613,649 T267A probably benign Het
Zfp335 G A 2: 164,909,365 P94S probably benign Het
Other mutations in Rab11fip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Rab11fip1 APN 8 27154776 missense possibly damaging 0.71
IGL01976:Rab11fip1 APN 8 27152797 missense possibly damaging 0.56
IGL02832:Rab11fip1 APN 8 27152812 missense possibly damaging 0.79
IGL02799:Rab11fip1 UTSW 8 27152760 missense probably benign 0.12
R0046:Rab11fip1 UTSW 8 27153121 missense probably damaging 0.99
R0046:Rab11fip1 UTSW 8 27153121 missense probably damaging 0.99
R0145:Rab11fip1 UTSW 8 27143324 missense probably damaging 1.00
R0243:Rab11fip1 UTSW 8 27152225 missense probably damaging 1.00
R0427:Rab11fip1 UTSW 8 27154492 missense probably damaging 0.99
R1341:Rab11fip1 UTSW 8 27143360 missense probably damaging 0.99
R1487:Rab11fip1 UTSW 8 27154212 missense probably damaging 0.99
R1509:Rab11fip1 UTSW 8 27153023 missense probably damaging 1.00
R1731:Rab11fip1 UTSW 8 27152410 missense probably damaging 0.98
R3832:Rab11fip1 UTSW 8 27152746 missense probably benign
R4157:Rab11fip1 UTSW 8 27152147 missense probably damaging 1.00
R4451:Rab11fip1 UTSW 8 27154477 missense probably damaging 1.00
R4595:Rab11fip1 UTSW 8 27154575 missense probably damaging 0.98
R4620:Rab11fip1 UTSW 8 27154215 missense probably damaging 1.00
R4753:Rab11fip1 UTSW 8 27152741 missense probably benign
R4834:Rab11fip1 UTSW 8 27153083 missense probably damaging 1.00
R4958:Rab11fip1 UTSW 8 27154813 missense probably damaging 0.99
R5102:Rab11fip1 UTSW 8 27156374 missense probably damaging 0.99
R5558:Rab11fip1 UTSW 8 27151975 missense probably damaging 1.00
R5752:Rab11fip1 UTSW 8 27156586 missense probably damaging 0.99
R5859:Rab11fip1 UTSW 8 27154720 missense probably damaging 1.00
R6525:Rab11fip1 UTSW 8 27156499 missense probably benign 0.45
R6527:Rab11fip1 UTSW 8 27174392 missense probably damaging 0.99
R6695:Rab11fip1 UTSW 8 27143234 missense probably damaging 1.00
R6730:Rab11fip1 UTSW 8 27143229 missense probably damaging 1.00
R6810:Rab11fip1 UTSW 8 27152732 frame shift probably null
R6925:Rab11fip1 UTSW 8 27152972 missense probably damaging 1.00
R6941:Rab11fip1 UTSW 8 27156275 nonsense probably null
R7481:Rab11fip1 UTSW 8 27156581 missense probably damaging 1.00
R7504:Rab11fip1 UTSW 8 27152953 missense possibly damaging 0.78
R7610:Rab11fip1 UTSW 8 27152036 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCTGACTTGGAAGTGGGCAG -3'
(R):5'- TGCTTCCATCCAGAGCTAACC -3'

Sequencing Primer
(F):5'- GCAGGACAGACATGGACTG -3'
(R):5'- TGGTACACCCTGAAGTCCAAAC -3'
Posted On2018-06-06