Incidental Mutation 'R6551:Clmp'
ID521630
Institutional Source Beutler Lab
Gene Symbol Clmp
Ensembl Gene ENSMUSG00000032024
Gene NameCXADR-like membrane protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6551 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location40685962-40785319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40771277 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 119 (V119A)
Ref Sequence ENSEMBL: ENSMUSP00000034522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034522]
Predicted Effect probably benign
Transcript: ENSMUST00000034522
AA Change: V119A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034522
Gene: ENSMUSG00000032024
AA Change: V119A

DomainStartEndE-ValueType
IG 19 128 3.46e-7 SMART
IGc2 143 214 1.29e-6 SMART
transmembrane domain 233 255 N/A INTRINSIC
low complexity region 287 313 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134153
Meta Mutation Damage Score 0.0779 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane protein that is localized to junctional complexes between endothelial and epithelial cells and may have a role in cell-cell adhesion. Expression of this gene in white adipose tissue is implicated in adipocyte maturation and development of obesity. This gene is also essential for normal intestinal development and mutations in the gene are associated with congenital short bowel syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a targeted null allele exhibit reduced viability, bilateral hydronephrosis, increased mean systolic blood pressure, and exhibit several blood chemistry and neurological anomalies. Null mice are samller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A T 1: 193,174,523 Q61L probably damaging Het
Acss2 T C 2: 155,551,208 S285P probably benign Het
Ager A G 17: 34,599,468 probably null Het
Alkbh7 T A 17: 56,998,945 Y115* probably null Het
Brwd1 T C 16: 95,993,962 D2184G possibly damaging Het
Chp1 T A 2: 119,571,813 H89Q possibly damaging Het
Cryge A T 1: 65,048,637 M171K probably benign Het
Cttnbp2nl A T 3: 105,005,117 S484T possibly damaging Het
Dsg3 C A 18: 20,539,911 P880T unknown Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Espn T C 4: 152,128,766 Het
Fbxo31 A C 8: 121,564,704 probably benign Het
Grin2b A G 6: 135,733,344 V1068A probably damaging Het
Jak1 C A 4: 101,193,843 probably benign Het
Klra10 A T 6: 130,275,755 D185E probably benign Het
Lhx1 A C 11: 84,521,913 D60E probably benign Het
Lyar C A 5: 38,233,272 A326D probably damaging Het
Muc16 A C 9: 18,562,562 S1280A possibly damaging Het
Nol9 G A 4: 152,051,868 V466I possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1120 T C 2: 87,846,661 V130A possibly damaging Het
Olfr1380 G T 11: 49,563,989 V23L probably benign Het
Olfr23 T C 11: 73,940,303 I19T probably benign Het
Olfr317 A T 11: 58,732,757 M136K probably damaging Het
Olfr959 C A 9: 39,572,560 R233L probably benign Het
Pik3c2a A T 7: 116,417,496 I342N probably damaging Het
Pnldc1 A G 17: 12,905,569 M133T probably damaging Het
Rab11fip1 G A 8: 27,156,484 S188L probably damaging Het
Rapgef2 A T 3: 79,215,035 probably null Het
Rnf103 G A 6: 71,510,365 C660Y probably damaging Het
Rph3al G A 11: 75,906,546 S108F possibly damaging Het
Srsf7 A C 17: 80,204,219 probably benign Het
Ssrp1 A G 2: 85,041,106 probably null Het
Tamm41 T C 6: 115,012,181 D284G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem39b A G 4: 129,692,103 V25A probably benign Het
Tmem88b G T 4: 155,785,692 probably benign Het
Unk T C 11: 116,050,724 W266R probably damaging Het
Usp8 T A 2: 126,733,182 probably benign Het
Zbtb48 T G 4: 152,022,221 Q142P probably benign Het
Zdhhc18 T C 4: 133,613,649 T267A probably benign Het
Zfp335 G A 2: 164,909,365 P94S probably benign Het
Other mutations in Clmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Clmp APN 9 40782610 makesense probably null
IGL01783:Clmp APN 9 40782407 missense possibly damaging 0.91
IGL02565:Clmp APN 9 40772415 missense probably damaging 1.00
IGL02953:Clmp APN 9 40774387 missense probably damaging 1.00
IGL02976:Clmp APN 9 40781224 missense possibly damaging 0.92
IGL03357:Clmp APN 9 40686327 utr 5 prime probably benign
IGL03383:Clmp APN 9 40774441 missense probably damaging 1.00
R0530:Clmp UTSW 9 40761006 missense probably benign 0.00
R0539:Clmp UTSW 9 40782486 missense probably benign 0.00
R1453:Clmp UTSW 9 40782441 missense probably damaging 0.98
R1623:Clmp UTSW 9 40782560 missense probably benign
R2899:Clmp UTSW 9 40782392 missense probably damaging 1.00
R4175:Clmp UTSW 9 40771136 missense probably benign 0.04
R5570:Clmp UTSW 9 40772530 critical splice donor site probably null
R6048:Clmp UTSW 9 40771109 missense probably damaging 1.00
R6240:Clmp UTSW 9 40782411 missense probably damaging 1.00
R7216:Clmp UTSW 9 40760909 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TACGTATTCCAGCCGTCATG -3'
(R):5'- ATAGCACTTGAGATGCAGGC -3'

Sequencing Primer
(F):5'- TGTCTACAATAACTTGACCGAGGAGC -3'
(R):5'- CTTTTAAGTCCAGCACTCAGGAGG -3'
Posted On2018-06-06