Incidental Mutation 'R6551:Olfr317'
ID521634
Institutional Source Beutler Lab
Gene Symbol Olfr317
Ensembl Gene ENSMUSG00000060030
Gene Nameolfactory receptor 317
SynonymsGA_x6K02T2NKPP-680866-681849, MOR256-47
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6551 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58731018-58739212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58732757 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 136 (M136K)
Ref Sequence ENSEMBL: ENSMUSP00000150027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075607] [ENSMUST00000215513] [ENSMUST00000216196]
Predicted Effect probably damaging
Transcript: ENSMUST00000075607
AA Change: M136K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075034
Gene: ENSMUSG00000060030
AA Change: M136K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-50 PFAM
Pfam:7tm_1 41 290 5.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215513
AA Change: M136K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216196
AA Change: M136K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A T 1: 193,174,523 Q61L probably damaging Het
Acss2 T C 2: 155,551,208 S285P probably benign Het
Ager A G 17: 34,599,468 probably null Het
Alkbh7 T A 17: 56,998,945 Y115* probably null Het
Brwd1 T C 16: 95,993,962 D2184G possibly damaging Het
Chp1 T A 2: 119,571,813 H89Q possibly damaging Het
Clmp T C 9: 40,771,277 V119A probably benign Het
Cryge A T 1: 65,048,637 M171K probably benign Het
Cttnbp2nl A T 3: 105,005,117 S484T possibly damaging Het
Dsg3 C A 18: 20,539,911 P880T unknown Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Espn T C 4: 152,128,766 Het
Fbxo31 A C 8: 121,564,704 probably benign Het
Grin2b A G 6: 135,733,344 V1068A probably damaging Het
Jak1 C A 4: 101,193,843 probably benign Het
Klra10 A T 6: 130,275,755 D185E probably benign Het
Lhx1 A C 11: 84,521,913 D60E probably benign Het
Lyar C A 5: 38,233,272 A326D probably damaging Het
Muc16 A C 9: 18,562,562 S1280A possibly damaging Het
Nol9 G A 4: 152,051,868 V466I possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1120 T C 2: 87,846,661 V130A possibly damaging Het
Olfr1380 G T 11: 49,563,989 V23L probably benign Het
Olfr23 T C 11: 73,940,303 I19T probably benign Het
Olfr959 C A 9: 39,572,560 R233L probably benign Het
Pik3c2a A T 7: 116,417,496 I342N probably damaging Het
Pnldc1 A G 17: 12,905,569 M133T probably damaging Het
Rab11fip1 G A 8: 27,156,484 S188L probably damaging Het
Rapgef2 A T 3: 79,215,035 probably null Het
Rnf103 G A 6: 71,510,365 C660Y probably damaging Het
Rph3al G A 11: 75,906,546 S108F possibly damaging Het
Srsf7 A C 17: 80,204,219 probably benign Het
Ssrp1 A G 2: 85,041,106 probably null Het
Tamm41 T C 6: 115,012,181 D284G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem39b A G 4: 129,692,103 V25A probably benign Het
Tmem88b G T 4: 155,785,692 probably benign Het
Unk T C 11: 116,050,724 W266R probably damaging Het
Usp8 T A 2: 126,733,182 probably benign Het
Zbtb48 T G 4: 152,022,221 Q142P probably benign Het
Zdhhc18 T C 4: 133,613,649 T267A probably benign Het
Zfp335 G A 2: 164,909,365 P94S probably benign Het
Other mutations in Olfr317
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02692:Olfr317 APN 11 58732517 missense probably benign 0.07
IGL03330:Olfr317 APN 11 58732919 missense probably damaging 1.00
R0554:Olfr317 UTSW 11 58733039 missense probably damaging 1.00
R1109:Olfr317 UTSW 11 58732916 missense probably benign 0.03
R2012:Olfr317 UTSW 11 58732388 missense possibly damaging 0.60
R2243:Olfr317 UTSW 11 58732445 missense probably damaging 1.00
R2253:Olfr317 UTSW 11 58732995 missense probably benign 0.23
R5400:Olfr317 UTSW 11 58732320 missense possibly damaging 0.74
R6944:Olfr317 UTSW 11 58732242 missense possibly damaging 0.93
R7144:Olfr317 UTSW 11 58732745 missense probably damaging 1.00
R7636:Olfr317 UTSW 11 58732447 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGCCTATTGCCAGGATGAAGG -3'
(R):5'- AGCTTCACCAGTAGCTCCATC -3'

Sequencing Primer
(F):5'- TTCAACGACAGCTGTGTTGACAC -3'
(R):5'- GTAGCTCCATCCCACAGCTG -3'
Posted On2018-06-06