Incidental Mutation 'R6524:Six3'
ID521637
Institutional Source Beutler Lab
Gene Symbol Six3
Ensembl Gene ENSMUSG00000038805
Gene Namesine oculis-related homeobox 3
SynonymsE130112M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6524 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location85613608-85629302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85621970 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 244 (T244I)
Ref Sequence ENSEMBL: ENSMUSP00000135312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162695] [ENSMUST00000175898] [ENSMUST00000176081]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159030
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161688
Predicted Effect probably damaging
Transcript: ENSMUST00000162695
AA Change: T244I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125169
Gene: ENSMUSG00000038805
AA Change: T244I

DomainStartEndE-ValueType
low complexity region 30 71 N/A INTRINSIC
HOX 208 269 1.26e-14 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175898
AA Change: T244I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135677
Gene: ENSMUSG00000038805
AA Change: T244I

DomainStartEndE-ValueType
low complexity region 30 71 N/A INTRINSIC
HOX 208 269 1.26e-14 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175913
Predicted Effect probably damaging
Transcript: ENSMUST00000176081
AA Change: T244I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135312
Gene: ENSMUSG00000038805
AA Change: T244I

DomainStartEndE-ValueType
low complexity region 51 92 N/A INTRINSIC
Pfam:SIX1_SD 109 223 6e-47 PFAM
HOX 229 290 6.5e-17 SMART
low complexity region 315 331 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177487
Meta Mutation Damage Score 0.8127 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sine oculis homeobox transcription factor family. The encoded protein plays a role in eye development. Mutations in this gene have been associated with holoprosencephaly type 2. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene die at birth with anterior structures of the head and brain undeveloped. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,009 R100G possibly damaging Het
Acin1 G T 14: 54,645,283 D237E probably damaging Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
C3 A T 17: 57,217,264 probably null Het
Dnaaf2 A T 12: 69,190,385 C650S probably benign Het
Dsg2 T G 18: 20,583,036 F315V probably damaging Het
Dyrk1a C T 16: 94,685,120 S404L probably benign Het
Eefsec T C 6: 88,297,920 probably null Het
Esco1 T G 18: 10,582,188 probably null Het
Fam83a T C 15: 57,995,340 probably null Het
Fat3 A T 9: 15,992,256 V2981E probably damaging Het
Gm6970 G A 19: 47,170,560 T192M unknown Het
Heatr5b A G 17: 78,814,106 L730P possibly damaging Het
Hgsnat A G 8: 25,945,232 S625P probably damaging Het
Itpr1 C T 6: 108,363,683 T84I probably damaging Het
Itpr2 T C 6: 146,345,211 N1070S probably benign Het
Itsn1 T C 16: 91,911,995 F276L probably damaging Het
Krt84 A G 15: 101,532,752 S2P unknown Het
Lbhd2 G A 12: 111,410,290 R57H probably damaging Het
Lcmt2 T C 2: 121,138,931 E337G possibly damaging Het
Lrp1b T C 2: 40,851,804 E3037G possibly damaging Het
Lrp2 T C 2: 69,436,639 E4308G possibly damaging Het
Med13 A G 11: 86,301,467 I824T probably damaging Het
Meiob G A 17: 24,832,517 V291I probably benign Het
Mtcl1 A T 17: 66,348,285 D1343E probably benign Het
Mybl2 C A 2: 163,074,530 P367Q possibly damaging Het
Nav3 T C 10: 109,720,030 N1680S probably damaging Het
Nif3l1 T C 1: 58,457,840 V308A probably benign Het
Olfr191 C T 16: 59,086,277 V69M possibly damaging Het
Pclo G A 5: 14,718,869 R4366H unknown Het
Phax T A 18: 56,587,002 D338E probably damaging Het
Pnpla6 T A 8: 3,534,519 probably null Het
Rint1 A T 5: 23,815,739 M529L probably benign Het
Scand1 C T 2: 156,312,249 probably benign Het
Slc4a4 T C 5: 89,232,764 S1034P probably benign Het
Ssu72 T G 4: 155,715,540 N53K probably null Het
Timm44 T C 8: 4,267,988 D140G possibly damaging Het
Tspan8 T C 10: 115,844,079 F200L probably benign Het
Tyw5 A T 1: 57,388,731 V234D possibly damaging Het
Ubxn10 T A 4: 138,720,883 R161* probably null Het
Vmn2r23 T A 6: 123,713,425 L420Q probably damaging Het
Wdr1 A T 5: 38,530,063 D208E probably benign Het
Yif1a A G 19: 5,092,176 Y230C probably damaging Het
Other mutations in Six3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03096:Six3 APN 17 85621937 missense possibly damaging 0.78
IGL03397:Six3 APN 17 85621646 missense probably damaging 1.00
FR4304:Six3 UTSW 17 85621368 small insertion probably benign
FR4340:Six3 UTSW 17 85621356 small insertion probably benign
FR4449:Six3 UTSW 17 85621362 small insertion probably benign
FR4548:Six3 UTSW 17 85621363 small insertion probably benign
FR4589:Six3 UTSW 17 85621365 small insertion probably benign
FR4737:Six3 UTSW 17 85621357 small insertion probably benign
FR4737:Six3 UTSW 17 85621358 small insertion probably benign
FR4737:Six3 UTSW 17 85621362 small insertion probably benign
FR4737:Six3 UTSW 17 85621363 small insertion probably benign
FR4737:Six3 UTSW 17 85621365 small insertion probably benign
FR4737:Six3 UTSW 17 85621368 small insertion probably benign
FR4976:Six3 UTSW 17 85621358 small insertion probably benign
FR4976:Six3 UTSW 17 85621371 small insertion probably benign
R0238:Six3 UTSW 17 85621390 missense probably damaging 1.00
R1264:Six3 UTSW 17 85621857 missense probably damaging 0.96
R2903:Six3 UTSW 17 85623855 missense probably damaging 0.96
R2916:Six3 UTSW 17 85621633 missense probably benign 0.25
R4994:Six3 UTSW 17 85621292 missense possibly damaging 0.91
R5393:Six3 UTSW 17 85623842 missense possibly damaging 0.93
RF003:Six3 UTSW 17 85621370 small insertion probably benign
RF010:Six3 UTSW 17 85621355 small insertion probably benign
RF011:Six3 UTSW 17 85621368 small insertion probably benign
RF012:Six3 UTSW 17 85621368 small insertion probably benign
RF014:Six3 UTSW 17 85621356 small insertion probably benign
RF015:Six3 UTSW 17 85621370 small insertion probably benign
RF022:Six3 UTSW 17 85621356 small insertion probably benign
RF054:Six3 UTSW 17 85621355 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TAAGGAGTCTCACGGCAAGC -3'
(R):5'- AGCACCGGTATCTCCAGAAC -3'

Sequencing Primer
(F):5'- CAAGCTGCAAGCCATGTG -3'
(R):5'- GAACTGGATCAGCCGCCTCTAC -3'
Posted On2018-06-06