Incidental Mutation 'R6551:Srsf7'
ID521656
Institutional Source Beutler Lab
Gene Symbol Srsf7
Ensembl Gene ENSMUSG00000024097
Gene Nameserine/arginine-rich splicing factor 7
SynonymsSfrs7, 9430065L19Rik, 9G8, NX-96
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6551 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location80200089-80207305 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 80204219 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063417] [ENSMUST00000134652]
Predicted Effect unknown
Transcript: ENSMUST00000063417
AA Change: S159A
SMART Domains Protein: ENSMUSP00000070983
Gene: ENSMUSG00000024097
AA Change: S159A

DomainStartEndE-ValueType
RRM 12 80 1.66e-20 SMART
ZnF_C2HC 105 121 1.77e-2 SMART
low complexity region 192 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134652
SMART Domains Protein: ENSMUSP00000123158
Gene: ENSMUSG00000046196

DomainStartEndE-ValueType
Pfam:DUF3808 69 522 7.2e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Five transcript variants, four of them protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130010J15Rik A T 1: 193,174,523 Q61L probably damaging Het
Acss2 T C 2: 155,551,208 S285P probably benign Het
Ager A G 17: 34,599,468 probably null Het
Alkbh7 T A 17: 56,998,945 Y115* probably null Het
Brwd1 T C 16: 95,993,962 D2184G possibly damaging Het
Chp1 T A 2: 119,571,813 H89Q possibly damaging Het
Clmp T C 9: 40,771,277 V119A probably benign Het
Cryge A T 1: 65,048,637 M171K probably benign Het
Cttnbp2nl A T 3: 105,005,117 S484T possibly damaging Het
Dsg3 C A 18: 20,539,911 P880T unknown Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Espn T C 4: 152,128,766 Het
Fbxo31 A C 8: 121,564,704 probably benign Het
Grin2b A G 6: 135,733,344 V1068A probably damaging Het
Jak1 C A 4: 101,193,843 probably benign Het
Klra10 A T 6: 130,275,755 D185E probably benign Het
Lhx1 A C 11: 84,521,913 D60E probably benign Het
Lyar C A 5: 38,233,272 A326D probably damaging Het
Muc16 A C 9: 18,562,562 S1280A possibly damaging Het
Nol9 G A 4: 152,051,868 V466I possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr1120 T C 2: 87,846,661 V130A possibly damaging Het
Olfr1380 G T 11: 49,563,989 V23L probably benign Het
Olfr23 T C 11: 73,940,303 I19T probably benign Het
Olfr317 A T 11: 58,732,757 M136K probably damaging Het
Olfr959 C A 9: 39,572,560 R233L probably benign Het
Pik3c2a A T 7: 116,417,496 I342N probably damaging Het
Pnldc1 A G 17: 12,905,569 M133T probably damaging Het
Rab11fip1 G A 8: 27,156,484 S188L probably damaging Het
Rapgef2 A T 3: 79,215,035 probably null Het
Rnf103 G A 6: 71,510,365 C660Y probably damaging Het
Rph3al G A 11: 75,906,546 S108F possibly damaging Het
Ssrp1 A G 2: 85,041,106 probably null Het
Tamm41 T C 6: 115,012,181 D284G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem39b A G 4: 129,692,103 V25A probably benign Het
Tmem88b G T 4: 155,785,692 probably benign Het
Unk T C 11: 116,050,724 W266R probably damaging Het
Usp8 T A 2: 126,733,182 probably benign Het
Zbtb48 T G 4: 152,022,221 Q142P probably benign Het
Zdhhc18 T C 4: 133,613,649 T267A probably benign Het
Zfp335 G A 2: 164,909,365 P94S probably benign Het
Other mutations in Srsf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Srsf7 APN 17 80202692 missense probably null
IGL02544:Srsf7 APN 17 80204191 unclassified probably benign
R1036:Srsf7 UTSW 17 80205837 unclassified probably benign
R3014:Srsf7 UTSW 17 80201561 missense unknown
R6004:Srsf7 UTSW 17 80205853 missense probably damaging 1.00
R6298:Srsf7 UTSW 17 80207253 unclassified probably benign
R7683:Srsf7 UTSW 17 80207274 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GAAGATACTTCACTGTGTCACCAAG -3'
(R):5'- GGTCACGATCTAGATCCCATTCC -3'

Sequencing Primer
(F):5'- CAATCCCAGTGATTAGGTGGC -3'
(R):5'- TAGATCCCATTCCCGATCCAGG -3'
Posted On2018-06-06