Mutagenetix > Incidental Mutations

Incidental Mutation 'R6552:Bpifa6'

521664

Institutional Source

Beutler Lab

Gene Symbol

Bpifa6

Ensembl Gene

ENSMUSG00000078998

Gene Name

BPI fold containing family A, member 6

Synonyms

Gm5840

MMRRC Submission

Accession Numbers

Genbank: NM_001080811; MGI: 3647736

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R6552 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

153974945-154000495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 153987158 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 202 (D202N)

Ref Sequence

ENSEMBL: ENSMUSP00000105375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109753]

AlphaFold

Q0VGU8

Predicted Effect

probably damaging
Transcript: ENSMUST00000109753
AA Change: D202N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105375
Gene: ENSMUSG00000078998
AA Change: D202N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:LBP_BPI_CETP	176	319	1.4e-9	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ang5	A	T	14: 43,962,797	H106L	probably benign	Het
Arsk	A	G	13: 76,072,196	Y260H	probably damaging	Het
Atxn2l	C	T	7: 126,493,821	V833M	possibly damaging	Het
Ccdc103	A	G	11: 102,884,144	S190G	probably benign	Het
Col6a6	C	T	9: 105,698,913	V2083I	probably damaging	Het
Creb5	A	G	6: 53,685,384	D222G	probably damaging	Het
Cyp7a1	C	T	4: 6,272,361	W284*	probably null	Het
Dnmt3a	T	C	12: 3,907,623	V868A	probably damaging	Het
Efr3a	A	G	15: 65,857,490	D680G	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Epb41l4a	A	G	18: 33,878,979	Y163H	probably damaging	Het
Gabra1	A	T	11: 42,147,099	S231T	probably damaging	Het
Golga4	T	A	9: 118,514,231	F42I	probably damaging	Het
Greb1l	G	A	18: 10,541,814	S1187N	probably benign	Het
Haspin	A	G	11: 73,137,564	V233A	probably benign	Het
Il34	T	A	8: 110,742,427	K187I	probably benign	Het
Kcnn2	A	G	18: 45,560,098	H247R	probably benign	Het
Klf5	T	C	14: 99,301,642	S84P	probably benign	Het
Lama5	G	T	2: 180,181,154	P2773Q	probably damaging	Het
Lcat	T	C	8: 105,939,679	M404V	possibly damaging	Het
Lrp6	A	T	6: 134,454,729	S1473T	probably benign	Het
Lsm3	GATATATA	GATATATATA	6: 91,519,635		probably null	Het
Mn1	T	C	5: 111,420,887	S908P	possibly damaging	Het
Olfr107	G	A	17: 37,405,905	R119H	probably benign	Het
Olfr695	TGAAGCC	T	7: 106,714,643		probably benign	Het
Pcdhb2	A	T	18: 37,295,993	M340L	probably benign	Het
Pex1	G	A	5: 3,623,953	E748K	probably damaging	Het
Qrich1	T	C	9: 108,534,305	V343A	possibly damaging	Het
Rho	A	G	6: 115,931,748		probably null	Het
Sdhaf4	C	A	1: 24,005,606		probably benign	Het
Sec24d	A	G	3: 123,290,552	I127V	probably benign	Het
Siae	T	C	9: 37,646,400	V501A	possibly damaging	Het
Skint3	T	C	4: 112,290,285	Y402H	possibly damaging	Het
Skint6	A	C	4: 113,067,490	V515G	possibly damaging	Het
Slc23a1	C	A	18: 35,622,338	G475C	probably damaging	Het
Smad9	A	G	3: 54,782,746	Y129C	probably damaging	Het
Snw1	A	G	12: 87,459,419		probably null	Het
Spice1	A	G	16: 44,379,033	D616G	possibly damaging	Het
Stam2	T	C	2: 52,708,227		probably null	Het
Sumo3	G	T	10: 77,606,257		probably benign	Het
Syne2	T	G	12: 75,890,241	N204K	possibly damaging	Het
Tmem200a	T	C	10: 25,993,483	N296S	probably damaging	Het
Ttbk1	G	T	17: 46,478,962	T125N	probably benign	Het
Ubr2	G	T	17: 46,966,268		probably null	Het
Vmn1r80	C	T	7: 12,193,757	L265F	probably damaging	Het
Vwa8	A	T	14: 79,198,222	T1791S	possibly damaging	Het

Other mutations in Bpifa6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00910:Bpifa6	APN	2	153990466	missense	probably benign	0.00
IGL01805:Bpifa6	APN	2	153984912	missense	probably benign	0.03
IGL02246:Bpifa6	APN	2	153989276	missense	probably damaging	0.98
IGL02275:Bpifa6	APN	2	153992272	missense	probably benign	0.40
IGL02405:Bpifa6	APN	2	153990862	nonsense	probably null
IGL02587:Bpifa6	APN	2	153989210	missense	probably damaging	0.99
IGL03365:Bpifa6	APN	2	153989284	missense	possibly damaging	0.71
F6893:Bpifa6	UTSW	2	153987158	missense	probably damaging	1.00
FR4976:Bpifa6	UTSW	2	153986376	missense	probably benign
FR4976:Bpifa6	UTSW	2	153986398	missense	probably benign
R0131:Bpifa6	UTSW	2	153982931	missense	probably benign	0.11
R0131:Bpifa6	UTSW	2	153982931	missense	probably benign	0.11
R0132:Bpifa6	UTSW	2	153982931	missense	probably benign	0.11
R0799:Bpifa6	UTSW	2	153992272	missense	probably benign	0.40
R1468:Bpifa6	UTSW	2	153989272	missense	probably benign	0.01
R1468:Bpifa6	UTSW	2	153989272	missense	probably benign	0.01
R1767:Bpifa6	UTSW	2	153987227	missense	possibly damaging	0.95
R2255:Bpifa6	UTSW	2	153990895	missense	probably damaging	0.98
R2857:Bpifa6	UTSW	2	153989274	missense	probably benign	0.03
R3430:Bpifa6	UTSW	2	153989251	missense	probably benign	0.00
R4616:Bpifa6	UTSW	2	153982988	missense	possibly damaging	0.47
R5420:Bpifa6	UTSW	2	153989330	missense	probably damaging	0.98
R6224:Bpifa6	UTSW	2	153987153	missense	probably damaging	0.99
R6483:Bpifa6	UTSW	2	153990434	missense	probably benign	0.13
R7061:Bpifa6	UTSW	2	153992316	missense	probably benign	0.00
R7378:Bpifa6	UTSW	2	153986433	missense	probably damaging	0.99
R7472:Bpifa6	UTSW	2	153989329	missense	possibly damaging	0.93
R8313:Bpifa6	UTSW	2	153989258	nonsense	probably null
R9193:Bpifa6	UTSW	2	153984820	missense	probably benign	0.38
R9309:Bpifa6	UTSW	2	153992287	missense	probably benign	0.03
R9316:Bpifa6	UTSW	2	153986463	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- CTGACTGATGCTTTTCCAATTTGGG -3'
(R):5'- TCATGTCATGGCAGAGCAGG -3'

Sequencing Primer
(F):5'- TTGGGATTTATAGAAATGGGACTCAG -3'
(R):5'- CTTCTAGTAACAGATGTCAGCCAGG -3'

Posted On

2018-06-06