Incidental Mutation 'R6552:Sec24d'
ID 521670
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene Name Sec24 related gene family, member D (S. cerevisiae)
Synonyms 2310020L09Rik, LOC383951
MMRRC Submission
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6552 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 123267455-123365641 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123290552 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 127 (I127V)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
AlphaFold Q6NXL1
Predicted Effect probably benign
Transcript: ENSMUST00000047923
AA Change: I127V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: I127V

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197291
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang5 A T 14: 43,962,797 H106L probably benign Het
Arsk A G 13: 76,072,196 Y260H probably damaging Het
Atxn2l C T 7: 126,493,821 V833M possibly damaging Het
Bpifa6 G A 2: 153,987,158 D202N probably damaging Het
Ccdc103 A G 11: 102,884,144 S190G probably benign Het
Col6a6 C T 9: 105,698,913 V2083I probably damaging Het
Creb5 A G 6: 53,685,384 D222G probably damaging Het
Cyp7a1 C T 4: 6,272,361 W284* probably null Het
Dnmt3a T C 12: 3,907,623 V868A probably damaging Het
Efr3a A G 15: 65,857,490 D680G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l4a A G 18: 33,878,979 Y163H probably damaging Het
Gabra1 A T 11: 42,147,099 S231T probably damaging Het
Golga4 T A 9: 118,514,231 F42I probably damaging Het
Greb1l G A 18: 10,541,814 S1187N probably benign Het
Haspin A G 11: 73,137,564 V233A probably benign Het
Il34 T A 8: 110,742,427 K187I probably benign Het
Kcnn2 A G 18: 45,560,098 H247R probably benign Het
Klf5 T C 14: 99,301,642 S84P probably benign Het
Lama5 G T 2: 180,181,154 P2773Q probably damaging Het
Lcat T C 8: 105,939,679 M404V possibly damaging Het
Lrp6 A T 6: 134,454,729 S1473T probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mn1 T C 5: 111,420,887 S908P possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr695 TGAAGCC T 7: 106,714,643 probably benign Het
Pcdhb2 A T 18: 37,295,993 M340L probably benign Het
Pex1 G A 5: 3,623,953 E748K probably damaging Het
Qrich1 T C 9: 108,534,305 V343A possibly damaging Het
Rho A G 6: 115,931,748 probably null Het
Sdhaf4 C A 1: 24,005,606 probably benign Het
Siae T C 9: 37,646,400 V501A possibly damaging Het
Skint3 T C 4: 112,290,285 Y402H possibly damaging Het
Skint6 A C 4: 113,067,490 V515G possibly damaging Het
Slc23a1 C A 18: 35,622,338 G475C probably damaging Het
Smad9 A G 3: 54,782,746 Y129C probably damaging Het
Snw1 A G 12: 87,459,419 probably null Het
Spice1 A G 16: 44,379,033 D616G possibly damaging Het
Stam2 T C 2: 52,708,227 probably null Het
Sumo3 G T 10: 77,606,257 probably benign Het
Syne2 T G 12: 75,890,241 N204K possibly damaging Het
Tmem200a T C 10: 25,993,483 N296S probably damaging Het
Ttbk1 G T 17: 46,478,962 T125N probably benign Het
Ubr2 G T 17: 46,966,268 probably null Het
Vmn1r80 C T 7: 12,193,757 L265F probably damaging Het
Vwa8 A T 14: 79,198,222 T1791S possibly damaging Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
R7481:Sec24d UTSW 3 123350763 missense probably damaging 1.00
R7554:Sec24d UTSW 3 123355774 missense probably damaging 1.00
R8270:Sec24d UTSW 3 123305886 missense possibly damaging 0.90
R8481:Sec24d UTSW 3 123353424 missense probably damaging 1.00
R8713:Sec24d UTSW 3 123343892 missense probably damaging 1.00
R8872:Sec24d UTSW 3 123354936 splice site probably benign
R8922:Sec24d UTSW 3 123350839 missense probably damaging 1.00
R8974:Sec24d UTSW 3 123305849 missense probably damaging 1.00
R9015:Sec24d UTSW 3 123327638 missense probably benign 0.43
R9050:Sec24d UTSW 3 123350725 missense probably benign 0.00
R9065:Sec24d UTSW 3 123355803 missense probably damaging 1.00
R9128:Sec24d UTSW 3 123294161 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCACACAGAGGACTTGTTTTAGG -3'
(R):5'- TGGCATGCCCGAGTTATGTC -3'

Sequencing Primer
(F):5'- TGCTTAAGATGCTCAGTGATGCTATC -3'
(R):5'- CCTAGCACATCTACGGTT -3'
Posted On 2018-06-06