Incidental Mutation 'R6552:Skint3'
ID521674
Institutional Source Beutler Lab
Gene Symbol Skint3
Ensembl Gene ENSMUSG00000070868
Gene Nameselection and upkeep of intraepithelial T cells 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6552 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location112232245-112300468 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112290285 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 402 (Y402H)
Ref Sequence ENSEMBL: ENSMUSP00000131300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038455] [ENSMUST00000170945]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038455
AA Change: Y330H

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042662
Gene: ENSMUSG00000070868
AA Change: Y330H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 34 141 3.51e-8 SMART
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 291 313 N/A INTRINSIC
transmembrane domain 328 350 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170945
AA Change: Y402H

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131300
Gene: ENSMUSG00000070868
AA Change: Y402H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 34 141 3.51e-8 SMART
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 285 304 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 362 384 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang5 A T 14: 43,962,797 H106L probably benign Het
Arsk A G 13: 76,072,196 Y260H probably damaging Het
Atxn2l C T 7: 126,493,821 V833M possibly damaging Het
Bpifa6 G A 2: 153,987,158 D202N probably damaging Het
Ccdc103 A G 11: 102,884,144 S190G probably benign Het
Col6a6 C T 9: 105,698,913 V2083I probably damaging Het
Creb5 A G 6: 53,685,384 D222G probably damaging Het
Cyp7a1 C T 4: 6,272,361 W284* probably null Het
Dnmt3a T C 12: 3,907,623 V868A probably damaging Het
Efr3a A G 15: 65,857,490 D680G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l4a A G 18: 33,878,979 Y163H probably damaging Het
Gabra1 A T 11: 42,147,099 S231T probably damaging Het
Golga4 T A 9: 118,514,231 F42I probably damaging Het
Greb1l G A 18: 10,541,814 S1187N probably benign Het
Haspin A G 11: 73,137,564 V233A probably benign Het
Il34 T A 8: 110,742,427 K187I probably benign Het
Kcnn2 A G 18: 45,560,098 H247R probably benign Het
Klf5 T C 14: 99,301,642 S84P probably benign Het
Lama5 G T 2: 180,181,154 P2773Q probably damaging Het
Lcat T C 8: 105,939,679 M404V possibly damaging Het
Lrp6 A T 6: 134,454,729 S1473T probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mn1 T C 5: 111,420,887 S908P possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr695 TGAAGCC T 7: 106,714,643 probably benign Het
Pcdhb2 A T 18: 37,295,993 M340L probably benign Het
Pex1 G A 5: 3,623,953 E748K probably damaging Het
Qrich1 T C 9: 108,534,305 V343A possibly damaging Het
Rho A G 6: 115,931,748 probably null Het
Sdhaf4 C A 1: 24,005,606 probably benign Het
Sec24d A G 3: 123,290,552 I127V probably benign Het
Siae T C 9: 37,646,400 V501A possibly damaging Het
Skint6 A C 4: 113,067,490 V515G possibly damaging Het
Slc23a1 C A 18: 35,622,338 G475C probably damaging Het
Smad9 A G 3: 54,782,746 Y129C probably damaging Het
Snw1 A G 12: 87,459,419 probably null Het
Spice1 A G 16: 44,379,033 D616G possibly damaging Het
Stam2 T C 2: 52,708,227 probably null Het
Sumo3 G T 10: 77,606,257 probably benign Het
Syne2 T G 12: 75,890,241 N204K possibly damaging Het
Tmem200a T C 10: 25,993,483 N296S probably damaging Het
Ttbk1 G T 17: 46,478,962 T125N probably benign Het
Ubr2 G T 17: 46,966,268 probably null Het
Vmn1r80 C T 7: 12,193,757 L265F probably damaging Het
Vwa8 A T 14: 79,198,222 T1791S possibly damaging Het
Other mutations in Skint3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Skint3 APN 4 112255909 splice site probably benign
IGL01344:Skint3 APN 4 112290322 missense possibly damaging 0.53
IGL02875:Skint3 APN 4 112255882 missense possibly damaging 0.88
IGL03308:Skint3 APN 4 112254067 missense probably damaging 1.00
IGL03372:Skint3 APN 4 112255906 splice site probably benign
R0043:Skint3 UTSW 4 112277623 missense probably damaging 0.98
R0671:Skint3 UTSW 4 112255777 nonsense probably null
R0747:Skint3 UTSW 4 112253905 missense probably damaging 1.00
R1191:Skint3 UTSW 4 112235742 start codon destroyed probably null 0.95
R2058:Skint3 UTSW 4 112255783 nonsense probably null
R3819:Skint3 UTSW 4 112255888 missense possibly damaging 0.68
R3893:Skint3 UTSW 4 112253918 missense probably damaging 0.97
R4166:Skint3 UTSW 4 112255635 missense possibly damaging 0.89
R4449:Skint3 UTSW 4 112270009 missense possibly damaging 0.74
R4662:Skint3 UTSW 4 112277666 nonsense probably null
R4790:Skint3 UTSW 4 112255898 missense possibly damaging 0.49
R5374:Skint3 UTSW 4 112298189 missense possibly damaging 0.81
R5570:Skint3 UTSW 4 112235798 missense probably benign 0.08
R6024:Skint3 UTSW 4 112290346 missense possibly damaging 0.66
R6306:Skint3 UTSW 4 112255875 missense probably damaging 1.00
R6619:Skint3 UTSW 4 112253864 missense probably damaging 1.00
R6972:Skint3 UTSW 4 112258892 missense probably damaging 0.98
Z1176:Skint3 UTSW 4 112253902 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTCTGTAGGCTAAATCTTTCC -3'
(R):5'- TCTCTCTAGAAACTAAGTTAACCTCAG -3'

Sequencing Primer
(F):5'- AAGTTTCATTATATAACAGAGGCTGG -3'
(R):5'- GAGAAAAGGCTTGTATTAGTCTTA -3'
Posted On2018-06-06