Incidental Mutation 'R6552:Mn1'
ID521680
Institutional Source Beutler Lab
Gene Symbol Mn1
Ensembl Gene ENSMUSG00000070576
Gene Namemeningioma 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6552 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location111417362-111457033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111420887 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 908 (S908P)
Ref Sequence ENSEMBL: ENSMUSP00000092034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094463]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094463
AA Change: S908P

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092034
Gene: ENSMUSG00000070576
AA Change: S908P

DomainStartEndE-ValueType
low complexity region 92 124 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 201 217 N/A INTRINSIC
low complexity region 291 303 N/A INTRINSIC
low complexity region 333 354 N/A INTRINSIC
coiled coil region 507 548 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 569 584 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
low complexity region 708 725 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
low complexity region 745 771 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 862 892 N/A INTRINSIC
low complexity region 913 933 N/A INTRINSIC
low complexity region 957 972 N/A INTRINSIC
low complexity region 1098 1110 N/A INTRINSIC
low complexity region 1134 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196957
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meningioma 1 (MN1) contains two sets of CAG repeats. It is disrupted by a balanced translocation (4;22) in a meningioma, and its inactivation may contribute to meningioma 32 pathogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die shortly after birth due to cleft palate. Development of several bones in the skull was abnormal with completely absent alisphenoid, squamosal, and vomer bones, hypoplastic basisphenoid, pterygoid, and presphenoid bones, and thinfrontal, parietal, and interparietal bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang5 A T 14: 43,962,797 H106L probably benign Het
Arsk A G 13: 76,072,196 Y260H probably damaging Het
Atxn2l C T 7: 126,493,821 V833M possibly damaging Het
Bpifa6 G A 2: 153,987,158 D202N probably damaging Het
Ccdc103 A G 11: 102,884,144 S190G probably benign Het
Col6a6 C T 9: 105,698,913 V2083I probably damaging Het
Creb5 A G 6: 53,685,384 D222G probably damaging Het
Cyp7a1 C T 4: 6,272,361 W284* probably null Het
Dnmt3a T C 12: 3,907,623 V868A probably damaging Het
Efr3a A G 15: 65,857,490 D680G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l4a A G 18: 33,878,979 Y163H probably damaging Het
Gabra1 A T 11: 42,147,099 S231T probably damaging Het
Golga4 T A 9: 118,514,231 F42I probably damaging Het
Greb1l G A 18: 10,541,814 S1187N probably benign Het
Haspin A G 11: 73,137,564 V233A probably benign Het
Il34 T A 8: 110,742,427 K187I probably benign Het
Kcnn2 A G 18: 45,560,098 H247R probably benign Het
Klf5 T C 14: 99,301,642 S84P probably benign Het
Lama5 G T 2: 180,181,154 P2773Q probably damaging Het
Lcat T C 8: 105,939,679 M404V possibly damaging Het
Lrp6 A T 6: 134,454,729 S1473T probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr695 TGAAGCC T 7: 106,714,643 probably benign Het
Pcdhb2 A T 18: 37,295,993 M340L probably benign Het
Pex1 G A 5: 3,623,953 E748K probably damaging Het
Qrich1 T C 9: 108,534,305 V343A possibly damaging Het
Rho A G 6: 115,931,748 probably null Het
Sdhaf4 C A 1: 24,005,606 probably benign Het
Sec24d A G 3: 123,290,552 I127V probably benign Het
Siae T C 9: 37,646,400 V501A possibly damaging Het
Skint3 T C 4: 112,290,285 Y402H possibly damaging Het
Skint6 A C 4: 113,067,490 V515G possibly damaging Het
Slc23a1 C A 18: 35,622,338 G475C probably damaging Het
Smad9 A G 3: 54,782,746 Y129C probably damaging Het
Snw1 A G 12: 87,459,419 probably null Het
Spice1 A G 16: 44,379,033 D616G possibly damaging Het
Stam2 T C 2: 52,708,227 probably null Het
Sumo3 G T 10: 77,606,257 probably benign Het
Syne2 T G 12: 75,890,241 N204K possibly damaging Het
Tmem200a T C 10: 25,993,483 N296S probably damaging Het
Ttbk1 G T 17: 46,478,962 T125N probably benign Het
Ubr2 G T 17: 46,966,268 probably null Het
Vmn1r80 C T 7: 12,193,757 L265F probably damaging Het
Vwa8 A T 14: 79,198,222 T1791S possibly damaging Het
Other mutations in Mn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Mn1 APN 5 111421547 missense possibly damaging 0.85
IGL01139:Mn1 APN 5 111421449 missense probably damaging 0.96
IGL01546:Mn1 APN 5 111421248 missense probably damaging 1.00
IGL02252:Mn1 APN 5 111421241 missense probably damaging 0.96
IGL02821:Mn1 APN 5 111421851 missense probably damaging 0.99
IGL03203:Mn1 APN 5 111421403 missense probably benign
Uebermus UTSW 5 111421886 splice site probably null
FR4342:Mn1 UTSW 5 111419706 small insertion probably benign
FR4449:Mn1 UTSW 5 111419710 small insertion probably benign
FR4548:Mn1 UTSW 5 111419698 small insertion probably benign
FR4976:Mn1 UTSW 5 111419702 small insertion probably benign
R0639:Mn1 UTSW 5 111419316 missense probably damaging 1.00
R0676:Mn1 UTSW 5 111421034 missense possibly damaging 0.52
R1537:Mn1 UTSW 5 111454780 missense probably damaging 0.96
R1638:Mn1 UTSW 5 111421569 missense probably damaging 1.00
R1739:Mn1 UTSW 5 111420014 missense possibly damaging 0.92
R1922:Mn1 UTSW 5 111418746 missense probably damaging 0.99
R2008:Mn1 UTSW 5 111418857 missense probably damaging 1.00
R2104:Mn1 UTSW 5 111454751 missense possibly damaging 0.72
R2519:Mn1 UTSW 5 111418552 missense possibly damaging 0.85
R3980:Mn1 UTSW 5 111421770 missense possibly damaging 0.85
R4008:Mn1 UTSW 5 111420169 missense probably benign
R4564:Mn1 UTSW 5 111420667 missense possibly damaging 0.93
R4647:Mn1 UTSW 5 111420083 missense probably benign
R4779:Mn1 UTSW 5 111419660 missense probably damaging 0.99
R4819:Mn1 UTSW 5 111419937 missense possibly damaging 0.93
R4962:Mn1 UTSW 5 111454786 missense possibly damaging 0.85
R5373:Mn1 UTSW 5 111421886 splice site probably null
R5374:Mn1 UTSW 5 111421886 splice site probably null
R5521:Mn1 UTSW 5 111421769 missense possibly damaging 0.72
R5633:Mn1 UTSW 5 111420326 missense possibly damaging 0.52
R5744:Mn1 UTSW 5 111420536 missense possibly damaging 0.93
R6050:Mn1 UTSW 5 111419397 missense probably damaging 1.00
R7206:Mn1 UTSW 5 111420512 missense possibly damaging 0.85
R7244:Mn1 UTSW 5 111418833 missense possibly damaging 0.78
RF025:Mn1 UTSW 5 111419705 nonsense probably null
RF027:Mn1 UTSW 5 111419705 small insertion probably benign
RF028:Mn1 UTSW 5 111419711 small insertion probably benign
RF032:Mn1 UTSW 5 111419711 small insertion probably benign
RF040:Mn1 UTSW 5 111419705 small insertion probably benign
Z1088:Mn1 UTSW 5 111418280 missense possibly damaging 0.85
Z1176:Mn1 UTSW 5 111420379 missense probably benign 0.08
Z1176:Mn1 UTSW 5 111454706 missense possibly damaging 0.93
Z1177:Mn1 UTSW 5 111420068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAACGTGACTTTCAACAAGAAG -3'
(R):5'- ACGTAAGGGCCTTCTCATGG -3'

Sequencing Primer
(F):5'- TGAGCCAGAACGAGCCC -3'
(R):5'- TCGGGCCTCGTTCACTGAG -3'
Posted On2018-06-06