Incidental Mutation 'R6525:Slc26a5'
ID521688
Institutional Source Beutler Lab
Gene Symbol Slc26a5
Ensembl Gene ENSMUSG00000029015
Gene Namesolute carrier family 26, member 5
SynonymsPres, prestin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6525 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location21810655-21865604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21820350 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 457 (D457G)
Ref Sequence ENSEMBL: ENSMUSP00000030878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030878] [ENSMUST00000115176] [ENSMUST00000127975] [ENSMUST00000142888]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030878
AA Change: D457G

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030878
Gene: ENSMUSG00000029015
AA Change: D457G

DomainStartEndE-ValueType
Pfam:Sulfate_transp 80 475 3.3e-109 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Pfam:STAS 526 709 3.3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115176
AA Change: D420G

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110830
Gene: ENSMUSG00000029015
AA Change: D420G

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 106 5.2e-9 PFAM
Pfam:Sulfate_transp 156 434 1.6e-65 PFAM
transmembrane domain 439 461 N/A INTRINSIC
Pfam:STAS 489 672 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127975
SMART Domains Protein: ENSMUSP00000118029
Gene: ENSMUSG00000029015

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 148 4.3e-33 PFAM
Pfam:Sulfate_transp 193 440 8.9e-56 PFAM
transmembrane domain 447 469 N/A INTRINSIC
Pfam:STAS 494 677 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142888
SMART Domains Protein: ENSMUSP00000118263
Gene: ENSMUSG00000029015

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 148 2.1e-33 PFAM
Pfam:Sulfate_transp 193 441 9.6e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150012
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.0%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26A/SulP transporter family. The protein functions as a molecular motor in motile outer hair cells (OHCs) of the cochlea, inducing changes in cell length that act to amplify sound levels. The transmembrane protein is an incomplete anion transporter, and does not allow anions to cross the cell membrane but instead undergoes a conformational change in response to changes in intracellular Cl- levels that results in a change in cell length. The protein functions at microsecond rates, which is several orders of magnitude faster than conventional molecular motor proteins. Mutations in this gene are potential candidates for causing neurosensory deafness. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
PHENOTYPE: Cochlear sensitivity is decreased in mutant due to a loss of outer hair cell electromotility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,137,659 E1447G probably benign Het
Acss2 A G 2: 155,550,417 N261S probably benign Het
Adcy8 C A 15: 64,737,394 G859* probably null Het
Agbl3 A T 6: 34,803,594 K496* probably null Het
Antxrl A T 14: 34,060,406 D182V probably damaging Het
Arid5b A G 10: 68,097,666 L559P possibly damaging Het
Azi2 T A 9: 118,047,595 S60T probably damaging Het
Bahcc1 T C 11: 120,285,222 Y1931H probably damaging Het
Cnga1 T A 5: 72,618,231 E49V probably damaging Het
Col3a1 A G 1: 45,347,179 N160D possibly damaging Het
Crem C A 18: 3,268,070 R267L probably damaging Het
Ddx52 T C 11: 83,953,319 probably null Het
Ddx6 T C 9: 44,623,629 I127T probably damaging Het
Dopey2 T A 16: 93,809,416 Y2094N probably damaging Het
Dst C A 1: 34,163,135 N181K probably damaging Het
Dusp7 A G 9: 106,369,284 K163E possibly damaging Het
Dynlt1a T A 17: 6,311,739 T55S probably benign Het
Enpp2 T C 15: 54,870,211 N451S probably benign Het
Faap100 C A 11: 120,378,764 probably null Het
Fam208b G A 13: 3,576,540 Q455* probably null Het
Fam53a T C 5: 33,607,918 N148S probably damaging Het
Fat2 T C 11: 55,283,800 D2029G probably damaging Het
Flcn A T 11: 59,794,172 N484K possibly damaging Het
Gbp10 T A 5: 105,236,084 E17D probably benign Het
Gm14226 T C 2: 155,025,083 V320A possibly damaging Het
Gna13 T C 11: 109,395,939 I196T probably damaging Het
Gorasp1 G T 9: 119,927,995 P374T possibly damaging Het
Hc T C 2: 34,991,224 D1461G probably benign Het
Hmcn1 T C 1: 150,697,566 N2111D probably damaging Het
Hs3st3b1 G A 11: 63,921,598 S97L probably benign Het
Hsdl2 A G 4: 59,612,696 T296A probably damaging Het
Impg2 A G 16: 56,205,149 D48G probably damaging Het
Kbtbd12 A T 6: 88,614,080 N383K probably benign Het
Kcnj12 T G 11: 61,069,571 F232V probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Ldhb T C 6: 142,490,465 D326G probably benign Het
Lrrc49 A G 9: 60,598,149 L607S probably damaging Het
Ltn1 A G 16: 87,420,186 S388P probably damaging Het
Mansc4 A G 6: 147,075,147 S324P probably benign Het
Meltf G A 16: 31,888,899 W368* probably null Het
Nacad A G 11: 6,602,255 L312P probably damaging Het
Ndc1 G T 4: 107,368,107 G7W probably benign Het
Nmral1 T A 16: 4,714,432 K172* probably null Het
Nol9 G T 4: 152,039,449 R32L probably damaging Het
Nsun5 A G 5: 135,375,058 Y296C probably damaging Het
Olfr1301 C T 2: 111,754,984 T245I probably benign Het
Oscp1 A G 4: 126,076,778 D120G possibly damaging Het
Parp14 C T 16: 35,860,441 C274Y probably benign Het
Pced1b T A 15: 97,384,798 H239Q possibly damaging Het
Pgap1 T C 1: 54,481,889 I865V probably benign Het
Ppp6r3 T A 19: 3,493,936 S360C probably damaging Het
Prb1 A G 6: 132,207,504 S389P unknown Het
Prr16 T G 18: 51,303,155 S235R probably benign Het
Rab11fip1 T C 8: 27,156,499 N183S probably benign Het
Rcn1 A G 2: 105,388,975 probably null Het
Rimkla C A 4: 119,468,091 A374S probably benign Het
Skint8 A T 4: 111,928,738 D127V probably damaging Het
Slc12a6 A G 2: 112,352,451 K724E probably damaging Het
Slc13a3 T C 2: 165,406,747 N537S unknown Het
Slx4ip T C 2: 137,000,218 V21A possibly damaging Het
Stt3b A G 9: 115,258,558 Y291H probably damaging Het
Syn3 G A 10: 86,467,052 P80S probably damaging Het
Tiam1 A T 16: 89,858,597 probably null Het
Tjp1 T C 7: 65,343,651 D58G probably damaging Het
Tmprss15 T A 16: 79,003,378 I621F probably damaging Het
Tns1 C T 1: 73,953,470 S683N probably damaging Het
Ttn A G 2: 76,943,092 L2322P probably damaging Het
Ugdh G T 5: 65,417,059 H409N probably damaging Het
Vmn2r81 T A 10: 79,293,726 M817K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zbtb34 A G 2: 33,412,133 V132A probably damaging Het
Zfp119b A G 17: 55,939,992 C33R possibly damaging Het
Other mutations in Slc26a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Slc26a5 APN 5 21815736 missense probably damaging 1.00
IGL02486:Slc26a5 APN 5 21846325 missense probably damaging 1.00
IGL02639:Slc26a5 APN 5 21819767 missense probably damaging 1.00
IGL02810:Slc26a5 APN 5 21813383 splice site probably benign
R0002:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R0002:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R0089:Slc26a5 UTSW 5 21811344 splice site probably null
R0136:Slc26a5 UTSW 5 21834347 missense probably damaging 1.00
R0212:Slc26a5 UTSW 5 21823549 nonsense probably null
R0522:Slc26a5 UTSW 5 21846345 missense probably damaging 0.96
R0557:Slc26a5 UTSW 5 21819764 missense probably damaging 1.00
R0711:Slc26a5 UTSW 5 21847232 missense probably damaging 1.00
R0959:Slc26a5 UTSW 5 21816961 missense probably benign 0.01
R1214:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R1471:Slc26a5 UTSW 5 21816964 missense probably benign 0.12
R1647:Slc26a5 UTSW 5 21813976 nonsense probably null
R1648:Slc26a5 UTSW 5 21813976 nonsense probably null
R1861:Slc26a5 UTSW 5 21816958 missense possibly damaging 0.93
R1875:Slc26a5 UTSW 5 21815727 missense probably benign 0.03
R2106:Slc26a5 UTSW 5 21823544 missense probably damaging 1.00
R2169:Slc26a5 UTSW 5 21813865 missense probably damaging 1.00
R2219:Slc26a5 UTSW 5 21823478 missense probably damaging 1.00
R2276:Slc26a5 UTSW 5 21823547 missense probably benign 0.39
R2281:Slc26a5 UTSW 5 21831510 missense possibly damaging 0.94
R2325:Slc26a5 UTSW 5 21819694 missense probably damaging 1.00
R4031:Slc26a5 UTSW 5 21847191 missense probably damaging 1.00
R4793:Slc26a5 UTSW 5 21837994 missense probably damaging 1.00
R4941:Slc26a5 UTSW 5 21820386 missense probably damaging 1.00
R5122:Slc26a5 UTSW 5 21847196 missense probably damaging 1.00
R5274:Slc26a5 UTSW 5 21813901 missense possibly damaging 0.74
R5312:Slc26a5 UTSW 5 21847260 missense probably damaging 0.99
R5628:Slc26a5 UTSW 5 21816976 missense probably benign 0.20
R5806:Slc26a5 UTSW 5 21823563 missense probably damaging 1.00
R6227:Slc26a5 UTSW 5 21821097 missense probably damaging 1.00
R6609:Slc26a5 UTSW 5 21819719 missense possibly damaging 0.93
R6885:Slc26a5 UTSW 5 21834344 missense probably damaging 1.00
R6974:Slc26a5 UTSW 5 21840572 missense probably damaging 1.00
R7001:Slc26a5 UTSW 5 21811336 missense probably damaging 1.00
R7027:Slc26a5 UTSW 5 21816974 missense possibly damaging 0.60
R7174:Slc26a5 UTSW 5 21813894 missense probably damaging 1.00
R7184:Slc26a5 UTSW 5 21837246 nonsense probably null
R7650:Slc26a5 UTSW 5 21834330 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCCCTACGAAGTATGCACGC -3'
(R):5'- AGAGCCCCTTGAGGAGTAAG -3'

Sequencing Primer
(F):5'- AGGTACACAGATGCGCATAC -3'
(R):5'- CCCCTTGAGGAGTAAGTGGGG -3'
Posted On2018-06-06