Incidental Mutation 'R6552:Qrich1'
ID521712
Institutional Source Beutler Lab
Gene Symbol Qrich1
Ensembl Gene ENSMUSG00000006673
Gene Nameglutamine-rich 1
Synonyms2610028H07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R6552 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108516806-108560163 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108534305 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 343 (V343A)
Ref Sequence ENSEMBL: ENSMUSP00000141267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006851] [ENSMUST00000112155] [ENSMUST00000193258] [ENSMUST00000194385] [ENSMUST00000194741] [ENSMUST00000195563]
Predicted Effect probably benign
Transcript: ENSMUST00000006851
AA Change: V343A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000006851
Gene: ENSMUSG00000006673
AA Change: V343A

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 597 761 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112155
AA Change: V343A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107782
Gene: ENSMUSG00000006673
AA Change: V343A

DomainStartEndE-ValueType
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Pfam:DUF3504 600 760 2.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193127
Predicted Effect possibly damaging
Transcript: ENSMUST00000193258
AA Change: V343A

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141267
Gene: ENSMUSG00000006673
AA Change: V343A

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 9e-3 SMART
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
low complexity region 419 443 N/A INTRINSIC
low complexity region 457 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194385
SMART Domains Protein: ENSMUSP00000142211
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1cy5a_ 9 45 8e-3 SMART
low complexity region 79 134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194741
SMART Domains Protein: ENSMUSP00000142233
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 4e-3 SMART
low complexity region 80 119 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194743
Predicted Effect probably benign
Transcript: ENSMUST00000195563
SMART Domains Protein: ENSMUSP00000141716
Gene: ENSMUSG00000006673

DomainStartEndE-ValueType
SCOP:d1dgna_ 7 48 9e-3 SMART
low complexity region 79 123 N/A INTRINSIC
low complexity region 128 146 N/A INTRINSIC
low complexity region 150 192 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects including overriding aorta, double outlet right ventricle with atrioventricular septal defects and ventricular non-compaction, as well as cleft palate, cystic kidneys, and thymus hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang5 A T 14: 43,962,797 H106L probably benign Het
Arsk A G 13: 76,072,196 Y260H probably damaging Het
Atxn2l C T 7: 126,493,821 V833M possibly damaging Het
Bpifa6 G A 2: 153,987,158 D202N probably damaging Het
Ccdc103 A G 11: 102,884,144 S190G probably benign Het
Col6a6 C T 9: 105,698,913 V2083I probably damaging Het
Creb5 A G 6: 53,685,384 D222G probably damaging Het
Cyp7a1 C T 4: 6,272,361 W284* probably null Het
Dnmt3a T C 12: 3,907,623 V868A probably damaging Het
Efr3a A G 15: 65,857,490 D680G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l4a A G 18: 33,878,979 Y163H probably damaging Het
Gabra1 A T 11: 42,147,099 S231T probably damaging Het
Golga4 T A 9: 118,514,231 F42I probably damaging Het
Greb1l G A 18: 10,541,814 S1187N probably benign Het
Haspin A G 11: 73,137,564 V233A probably benign Het
Il34 T A 8: 110,742,427 K187I probably benign Het
Kcnn2 A G 18: 45,560,098 H247R probably benign Het
Klf5 T C 14: 99,301,642 S84P probably benign Het
Lama5 G T 2: 180,181,154 P2773Q probably damaging Het
Lcat T C 8: 105,939,679 M404V possibly damaging Het
Lrp6 A T 6: 134,454,729 S1473T probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mn1 T C 5: 111,420,887 S908P possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr695 TGAAGCC T 7: 106,714,643 probably benign Het
Pcdhb2 A T 18: 37,295,993 M340L probably benign Het
Pex1 G A 5: 3,623,953 E748K probably damaging Het
Rho A G 6: 115,931,748 probably null Het
Sdhaf4 C A 1: 24,005,606 probably benign Het
Sec24d A G 3: 123,290,552 I127V probably benign Het
Siae T C 9: 37,646,400 V501A possibly damaging Het
Skint3 T C 4: 112,290,285 Y402H possibly damaging Het
Skint6 A C 4: 113,067,490 V515G possibly damaging Het
Slc23a1 C A 18: 35,622,338 G475C probably damaging Het
Smad9 A G 3: 54,782,746 Y129C probably damaging Het
Snw1 A G 12: 87,459,419 probably null Het
Spice1 A G 16: 44,379,033 D616G possibly damaging Het
Stam2 T C 2: 52,708,227 probably null Het
Sumo3 G T 10: 77,606,257 probably benign Het
Syne2 T G 12: 75,890,241 N204K possibly damaging Het
Tmem200a T C 10: 25,993,483 N296S probably damaging Het
Ttbk1 G T 17: 46,478,962 T125N probably benign Het
Ubr2 G T 17: 46,966,268 probably null Het
Vmn1r80 C T 7: 12,193,757 L265F probably damaging Het
Vwa8 A T 14: 79,198,222 T1791S possibly damaging Het
Other mutations in Qrich1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03136:Qrich1 APN 9 108544918 missense probably damaging 1.00
R0240:Qrich1 UTSW 9 108534134 missense probably damaging 1.00
R0240:Qrich1 UTSW 9 108534134 missense probably damaging 1.00
R0586:Qrich1 UTSW 9 108534520 missense probably damaging 0.98
R0648:Qrich1 UTSW 9 108544877 missense probably damaging 1.00
R1460:Qrich1 UTSW 9 108533647 unclassified probably benign
R1478:Qrich1 UTSW 9 108559332 missense probably benign 0.02
R1631:Qrich1 UTSW 9 108534485 missense probably damaging 0.99
R1964:Qrich1 UTSW 9 108534422 missense possibly damaging 0.92
R1984:Qrich1 UTSW 9 108534047 missense probably damaging 0.99
R2054:Qrich1 UTSW 9 108559270 missense possibly damaging 0.92
R4539:Qrich1 UTSW 9 108534200 missense probably damaging 1.00
R5031:Qrich1 UTSW 9 108541736 missense possibly damaging 0.70
R5353:Qrich1 UTSW 9 108544965 missense probably damaging 1.00
R5510:Qrich1 UTSW 9 108556460 missense possibly damaging 0.69
R5604:Qrich1 UTSW 9 108559303 unclassified probably null
R5718:Qrich1 UTSW 9 108528823 missense probably damaging 1.00
R5743:Qrich1 UTSW 9 108534115 missense probably damaging 1.00
R5853:Qrich1 UTSW 9 108533608 unclassified probably benign
R6317:Qrich1 UTSW 9 108534292 missense probably damaging 1.00
R6470:Qrich1 UTSW 9 108534518 missense probably damaging 0.98
R6671:Qrich1 UTSW 9 108533786 missense probably benign 0.03
R6858:Qrich1 UTSW 9 108534134 missense probably damaging 1.00
R7453:Qrich1 UTSW 9 108556476 missense possibly damaging 0.93
R7842:Qrich1 UTSW 9 108556368 intron probably null
R7879:Qrich1 UTSW 9 108559286 missense possibly damaging 0.92
R7925:Qrich1 UTSW 9 108556368 intron probably null
R7962:Qrich1 UTSW 9 108559286 missense possibly damaging 0.92
R8073:Qrich1 UTSW 9 108534428 missense possibly damaging 0.56
R8158:Qrich1 UTSW 9 108556037 missense probably damaging 0.99
Z1177:Qrich1 UTSW 9 108534469 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGCAACAGAGTTATGTGTC -3'
(R):5'- TGGTATGTGCCTGCTACAGC -3'

Sequencing Primer
(F):5'- TGTCTTTGAGGCCAGACTTAC -3'
(R):5'- CCTGCACAGCCACTGGAATG -3'
Posted On2018-06-06