Incidental Mutation 'R6552:Tmem200a'
ID521716
Institutional Source Beutler Lab
Gene Symbol Tmem200a
Ensembl Gene ENSMUSG00000049420
Gene Nametransmembrane protein 200A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6552 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location25912331-26079052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25993483 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 296 (N296S)
Ref Sequence ENSEMBL: ENSMUSP00000151861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066049] [ENSMUST00000218232] [ENSMUST00000219338] [ENSMUST00000219651] [ENSMUST00000219872]
Predicted Effect probably damaging
Transcript: ENSMUST00000066049
AA Change: N296S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064080
Gene: ENSMUSG00000049420
AA Change: N296S

DomainStartEndE-ValueType
Pfam:DUF2371 16 161 8.9e-62 PFAM
low complexity region 262 279 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217910
Predicted Effect probably damaging
Transcript: ENSMUST00000218232
AA Change: N296S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000219338
Predicted Effect probably benign
Transcript: ENSMUST00000219651
Predicted Effect probably benign
Transcript: ENSMUST00000219872
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang5 A T 14: 43,962,797 H106L probably benign Het
Arsk A G 13: 76,072,196 Y260H probably damaging Het
Atxn2l C T 7: 126,493,821 V833M possibly damaging Het
Bpifa6 G A 2: 153,987,158 D202N probably damaging Het
Ccdc103 A G 11: 102,884,144 S190G probably benign Het
Col6a6 C T 9: 105,698,913 V2083I probably damaging Het
Creb5 A G 6: 53,685,384 D222G probably damaging Het
Cyp7a1 C T 4: 6,272,361 W284* probably null Het
Dnmt3a T C 12: 3,907,623 V868A probably damaging Het
Efr3a A G 15: 65,857,490 D680G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l4a A G 18: 33,878,979 Y163H probably damaging Het
Gabra1 A T 11: 42,147,099 S231T probably damaging Het
Golga4 T A 9: 118,514,231 F42I probably damaging Het
Greb1l G A 18: 10,541,814 S1187N probably benign Het
Haspin A G 11: 73,137,564 V233A probably benign Het
Il34 T A 8: 110,742,427 K187I probably benign Het
Kcnn2 A G 18: 45,560,098 H247R probably benign Het
Klf5 T C 14: 99,301,642 S84P probably benign Het
Lama5 G T 2: 180,181,154 P2773Q probably damaging Het
Lcat T C 8: 105,939,679 M404V possibly damaging Het
Lrp6 A T 6: 134,454,729 S1473T probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mn1 T C 5: 111,420,887 S908P possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr695 TGAAGCC T 7: 106,714,643 probably benign Het
Pcdhb2 A T 18: 37,295,993 M340L probably benign Het
Pex1 G A 5: 3,623,953 E748K probably damaging Het
Qrich1 T C 9: 108,534,305 V343A possibly damaging Het
Rho A G 6: 115,931,748 probably null Het
Sdhaf4 C A 1: 24,005,606 probably benign Het
Sec24d A G 3: 123,290,552 I127V probably benign Het
Siae T C 9: 37,646,400 V501A possibly damaging Het
Skint3 T C 4: 112,290,285 Y402H possibly damaging Het
Skint6 A C 4: 113,067,490 V515G possibly damaging Het
Slc23a1 C A 18: 35,622,338 G475C probably damaging Het
Smad9 A G 3: 54,782,746 Y129C probably damaging Het
Snw1 A G 12: 87,459,419 probably null Het
Spice1 A G 16: 44,379,033 D616G possibly damaging Het
Stam2 T C 2: 52,708,227 probably null Het
Sumo3 G T 10: 77,606,257 probably benign Het
Syne2 T G 12: 75,890,241 N204K possibly damaging Het
Ttbk1 G T 17: 46,478,962 T125N probably benign Het
Ubr2 G T 17: 46,966,268 probably null Het
Vmn1r80 C T 7: 12,193,757 L265F probably damaging Het
Vwa8 A T 14: 79,198,222 T1791S possibly damaging Het
Other mutations in Tmem200a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Tmem200a APN 10 25994143 missense probably damaging 0.98
IGL02323:Tmem200a APN 10 25993430 missense probably benign 0.12
IGL02702:Tmem200a APN 10 25993603 missense probably damaging 1.00
IGL03221:Tmem200a APN 10 25994024 missense possibly damaging 0.54
R0467:Tmem200a UTSW 10 25994104 missense probably benign 0.09
R1169:Tmem200a UTSW 10 25994348 missense probably damaging 1.00
R1543:Tmem200a UTSW 10 26078620 unclassified probably benign
R1555:Tmem200a UTSW 10 25993884 missense probably damaging 1.00
R1630:Tmem200a UTSW 10 25992914 missense probably damaging 1.00
R1693:Tmem200a UTSW 10 25993979 missense possibly damaging 0.94
R1786:Tmem200a UTSW 10 25993927 missense probably damaging 1.00
R1891:Tmem200a UTSW 10 25994072 missense probably damaging 1.00
R2113:Tmem200a UTSW 10 25993322 missense probably damaging 1.00
R2260:Tmem200a UTSW 10 25993415 missense probably benign
R3793:Tmem200a UTSW 10 25994189 missense probably damaging 1.00
R5062:Tmem200a UTSW 10 25993915 missense probably damaging 1.00
R5178:Tmem200a UTSW 10 25994379 missense probably benign 0.02
R5195:Tmem200a UTSW 10 26078956 unclassified probably benign
R5208:Tmem200a UTSW 10 25994153 missense probably benign 0.00
R6045:Tmem200a UTSW 10 25993007 missense probably damaging 1.00
R6319:Tmem200a UTSW 10 25993495 missense probably damaging 1.00
R7797:Tmem200a UTSW 10 25993966 missense possibly damaging 0.95
R8009:Tmem200a UTSW 10 25994006 missense probably damaging 1.00
R8074:Tmem200a UTSW 10 25992952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCCACAGAGGACTTGTATTG -3'
(R):5'- GATGTTGACTGAAAGTAAGAGCCTG -3'

Sequencing Primer
(F):5'- CTTGTATTGACTAGATAGGGACTCCC -3'
(R):5'- TGACAGTGCAGTCTCTGT -3'
Posted On2018-06-06