Incidental Mutation 'R6552:Ccdc103'
ID521724
Institutional Source Beutler Lab
Gene Symbol Ccdc103
Ensembl Gene ENSMUSG00000020930
Gene Namecoiled-coil domain containing 103
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6552 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location102881204-102885216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102884144 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 190 (S190G)
Ref Sequence ENSEMBL: ENSMUSP00000021307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021306] [ENSMUST00000021307] [ENSMUST00000067444] [ENSMUST00000100369] [ENSMUST00000107060] [ENSMUST00000159834]
Predicted Effect probably benign
Transcript: ENSMUST00000021306
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021307
AA Change: S190G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000021307
Gene: ENSMUSG00000020930
AA Change: S190G

DomainStartEndE-ValueType
Pfam:Dynein_attach_N 7 74 3.3e-32 PFAM
Pfam:RPAP3_C 98 188 1.2e-19 PFAM
low complexity region 219 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067444
SMART Domains Protein: ENSMUSP00000064691
Gene: ENSMUSG00000020932

DomainStartEndE-ValueType
Pfam:Filament_head 2 64 1.7e-8 PFAM
Filament 65 373 2.34e-136 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100369
SMART Domains Protein: ENSMUSP00000097938
Gene: ENSMUSG00000075510

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 39 142 3.73e0 SMART
IG_like 275 361 1.61e1 SMART
transmembrane domain 377 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107060
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148209
Predicted Effect probably benign
Transcript: ENSMUST00000159834
SMART Domains Protein: ENSMUSP00000125214
Gene: ENSMUSG00000020930

DomainStartEndE-ValueType
coiled coil region 8 33 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181125
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a coiled-coil domain. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang5 A T 14: 43,962,797 H106L probably benign Het
Arsk A G 13: 76,072,196 Y260H probably damaging Het
Atxn2l C T 7: 126,493,821 V833M possibly damaging Het
Bpifa6 G A 2: 153,987,158 D202N probably damaging Het
Col6a6 C T 9: 105,698,913 V2083I probably damaging Het
Creb5 A G 6: 53,685,384 D222G probably damaging Het
Cyp7a1 C T 4: 6,272,361 W284* probably null Het
Dnmt3a T C 12: 3,907,623 V868A probably damaging Het
Efr3a A G 15: 65,857,490 D680G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l4a A G 18: 33,878,979 Y163H probably damaging Het
Gabra1 A T 11: 42,147,099 S231T probably damaging Het
Golga4 T A 9: 118,514,231 F42I probably damaging Het
Greb1l G A 18: 10,541,814 S1187N probably benign Het
Haspin A G 11: 73,137,564 V233A probably benign Het
Il34 T A 8: 110,742,427 K187I probably benign Het
Kcnn2 A G 18: 45,560,098 H247R probably benign Het
Klf5 T C 14: 99,301,642 S84P probably benign Het
Lama5 G T 2: 180,181,154 P2773Q probably damaging Het
Lcat T C 8: 105,939,679 M404V possibly damaging Het
Lrp6 A T 6: 134,454,729 S1473T probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mn1 T C 5: 111,420,887 S908P possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr695 TGAAGCC T 7: 106,714,643 probably benign Het
Pcdhb2 A T 18: 37,295,993 M340L probably benign Het
Pex1 G A 5: 3,623,953 E748K probably damaging Het
Qrich1 T C 9: 108,534,305 V343A possibly damaging Het
Rho A G 6: 115,931,748 probably null Het
Sdhaf4 C A 1: 24,005,606 probably benign Het
Sec24d A G 3: 123,290,552 I127V probably benign Het
Siae T C 9: 37,646,400 V501A possibly damaging Het
Skint3 T C 4: 112,290,285 Y402H possibly damaging Het
Skint6 A C 4: 113,067,490 V515G possibly damaging Het
Slc23a1 C A 18: 35,622,338 G475C probably damaging Het
Smad9 A G 3: 54,782,746 Y129C probably damaging Het
Snw1 A G 12: 87,459,419 probably null Het
Spice1 A G 16: 44,379,033 D616G possibly damaging Het
Stam2 T C 2: 52,708,227 probably null Het
Sumo3 G T 10: 77,606,257 probably benign Het
Syne2 T G 12: 75,890,241 N204K possibly damaging Het
Tmem200a T C 10: 25,993,483 N296S probably damaging Het
Ttbk1 G T 17: 46,478,962 T125N probably benign Het
Ubr2 G T 17: 46,966,268 probably null Het
Vmn1r80 C T 7: 12,193,757 L265F probably damaging Het
Vwa8 A T 14: 79,198,222 T1791S possibly damaging Het
Other mutations in Ccdc103
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1909:Ccdc103 UTSW 11 102882566 missense probably benign 0.20
R4073:Ccdc103 UTSW 11 102884099 missense probably damaging 1.00
R5000:Ccdc103 UTSW 11 102884106 missense probably benign 0.00
R5729:Ccdc103 UTSW 11 102883078 missense probably damaging 1.00
R6774:Ccdc103 UTSW 11 102882693 missense probably damaging 1.00
R7115:Ccdc103 UTSW 11 102883810 missense possibly damaging 0.92
X0026:Ccdc103 UTSW 11 102882582 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TACCAGGCCCTACTTCAGCTTG -3'
(R):5'- AAATGCCTTCTGAGACCACTGAG -3'

Sequencing Primer
(F):5'- CAAGCTGGGCCACCTCTTC -3'
(R):5'- CCTTCTGAGACCACTGAGGAATG -3'
Posted On2018-06-06