Incidental Mutation 'R6552:Arsk'
ID521732
Institutional Source Beutler Lab
Gene Symbol Arsk
Ensembl Gene ENSMUSG00000021592
Gene Namearylsulfatase K
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6552 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location76060422-76098660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76072196 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 260 (Y260H)
Ref Sequence ENSEMBL: ENSMUSP00000113274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120573] [ENSMUST00000223579]
Predicted Effect probably damaging
Transcript: ENSMUST00000120573
AA Change: Y260H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113274
Gene: ENSMUSG00000021592
AA Change: Y260H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sulfatase 35 371 6e-49 PFAM
low complexity region 381 392 N/A INTRINSIC
low complexity region 537 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225642
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfatases (EC 3.1.5.6), such as ARSK, hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules (Sardiello et al., 2005 [PubMed 16174644]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang5 A T 14: 43,962,797 H106L probably benign Het
Atxn2l C T 7: 126,493,821 V833M possibly damaging Het
Bpifa6 G A 2: 153,987,158 D202N probably damaging Het
Ccdc103 A G 11: 102,884,144 S190G probably benign Het
Col6a6 C T 9: 105,698,913 V2083I probably damaging Het
Creb5 A G 6: 53,685,384 D222G probably damaging Het
Cyp7a1 C T 4: 6,272,361 W284* probably null Het
Dnmt3a T C 12: 3,907,623 V868A probably damaging Het
Efr3a A G 15: 65,857,490 D680G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l4a A G 18: 33,878,979 Y163H probably damaging Het
Gabra1 A T 11: 42,147,099 S231T probably damaging Het
Golga4 T A 9: 118,514,231 F42I probably damaging Het
Greb1l G A 18: 10,541,814 S1187N probably benign Het
Haspin A G 11: 73,137,564 V233A probably benign Het
Il34 T A 8: 110,742,427 K187I probably benign Het
Kcnn2 A G 18: 45,560,098 H247R probably benign Het
Klf5 T C 14: 99,301,642 S84P probably benign Het
Lama5 G T 2: 180,181,154 P2773Q probably damaging Het
Lcat T C 8: 105,939,679 M404V possibly damaging Het
Lrp6 A T 6: 134,454,729 S1473T probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mn1 T C 5: 111,420,887 S908P possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr695 TGAAGCC T 7: 106,714,643 probably benign Het
Pcdhb2 A T 18: 37,295,993 M340L probably benign Het
Pex1 G A 5: 3,623,953 E748K probably damaging Het
Qrich1 T C 9: 108,534,305 V343A possibly damaging Het
Rho A G 6: 115,931,748 probably null Het
Sdhaf4 C A 1: 24,005,606 probably benign Het
Sec24d A G 3: 123,290,552 I127V probably benign Het
Siae T C 9: 37,646,400 V501A possibly damaging Het
Skint3 T C 4: 112,290,285 Y402H possibly damaging Het
Skint6 A C 4: 113,067,490 V515G possibly damaging Het
Slc23a1 C A 18: 35,622,338 G475C probably damaging Het
Smad9 A G 3: 54,782,746 Y129C probably damaging Het
Snw1 A G 12: 87,459,419 probably null Het
Spice1 A G 16: 44,379,033 D616G possibly damaging Het
Stam2 T C 2: 52,708,227 probably null Het
Sumo3 G T 10: 77,606,257 probably benign Het
Syne2 T G 12: 75,890,241 N204K possibly damaging Het
Tmem200a T C 10: 25,993,483 N296S probably damaging Het
Ttbk1 G T 17: 46,478,962 T125N probably benign Het
Ubr2 G T 17: 46,966,268 probably null Het
Vmn1r80 C T 7: 12,193,757 L265F probably damaging Het
Vwa8 A T 14: 79,198,222 T1791S possibly damaging Het
Other mutations in Arsk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Arsk APN 13 76098368 splice site probably null
IGL02537:Arsk APN 13 76074906 nonsense probably null
IGL02691:Arsk APN 13 76074950 missense probably damaging 0.98
IGL03038:Arsk APN 13 76065513 splice site probably benign
PIT4480001:Arsk UTSW 13 76062365 missense probably damaging 1.00
R0277:Arsk UTSW 13 76074932 missense probably benign 0.01
R0900:Arsk UTSW 13 76098457 unclassified probably benign
R1441:Arsk UTSW 13 76074964 missense probably benign 0.01
R1748:Arsk UTSW 13 76062410 missense probably benign 0.15
R1923:Arsk UTSW 13 76066866 splice site probably benign
R2131:Arsk UTSW 13 76091812 nonsense probably null
R3723:Arsk UTSW 13 76066653 missense probably damaging 0.98
R4088:Arsk UTSW 13 76098414 missense probably benign
R4851:Arsk UTSW 13 76065279 critical splice donor site probably null
R5406:Arsk UTSW 13 76093947 missense probably benign
R5629:Arsk UTSW 13 76093908 missense probably damaging 1.00
R5869:Arsk UTSW 13 76091784 missense probably benign 0.29
R6217:Arsk UTSW 13 76091816 missense unknown
R6560:Arsk UTSW 13 76074986 missense probably benign 0.33
R6726:Arsk UTSW 13 76074788 missense probably damaging 1.00
R7421:Arsk UTSW 13 76062515 missense possibly damaging 0.81
R8178:Arsk UTSW 13 76091742 missense probably damaging 1.00
R8274:Arsk UTSW 13 76072184 missense probably damaging 1.00
X0050:Arsk UTSW 13 76065280 missense probably null 0.78
X0066:Arsk UTSW 13 76062456 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCAACTGCTTCGTGAGATATCTG -3'
(R):5'- CCAGAGGCTATTCTTTCCCG -3'

Sequencing Primer
(F):5'- CGTGAGATATCTGAGGATGCTCC -3'
(R):5'- TCCCGTCATTCTATGTAGGAAAC -3'
Posted On2018-06-06