Incidental Mutation 'R6525:Hs3st3b1'
ID521737
Institutional Source Beutler Lab
Gene Symbol Hs3st3b1
Ensembl Gene ENSMUSG00000070407
Gene Nameheparan sulfate (glucosamine) 3-O-sulfotransferase 3B1
Synonyms3OST3B1, m3-OST-3B, 3-OST-3B, HS3ST3B1, 3Ost3b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6525 (G1)
Quality Score112.008
Status Validated
Chromosome11
Chromosomal Location63885792-63922290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63921598 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 97 (S97L)
Ref Sequence ENSEMBL: ENSMUSP00000091647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094103]
Predicted Effect probably benign
Transcript: ENSMUST00000094103
AA Change: S97L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091647
Gene: ENSMUSG00000070407
AA Change: S97L

DomainStartEndE-ValueType
Pfam:Sulfotransfer_3 6 318 1.7e-11 PFAM
Pfam:Sulfotransfer_1 137 383 6.3e-48 PFAM
Meta Mutation Damage Score 0.1184 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.0%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II integral membrane protein that belongs to the 3-O-sulfotransferases family. These proteins catalyze the addition of sulfate groups at the 3-OH position of glucosamine in heparan sulfate. The substrate specificity of individual members of the family is based on prior modification of the heparan sulfate chain, thus allowing different members of the family to generate binding sites for different proteins on the same heparan sulfate chain. Following treatment with a histone deacetylase inhibitor, expression of this gene is activated in a pancreatic cell line. The increased expression results in promotion of the epithelial-mesenchymal transition. In addition, the modification catalyzed by this protein allows herpes simplex virus membrane fusion and penetration. A very closely related homolog with an almost identical sulfotransferase domain maps less than 1 Mb away. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,137,659 E1447G probably benign Het
Acss2 A G 2: 155,550,417 N261S probably benign Het
Adcy8 C A 15: 64,737,394 G859* probably null Het
Agbl3 A T 6: 34,803,594 K496* probably null Het
Antxrl A T 14: 34,060,406 D182V probably damaging Het
Arid5b A G 10: 68,097,666 L559P possibly damaging Het
Azi2 T A 9: 118,047,595 S60T probably damaging Het
Bahcc1 T C 11: 120,285,222 Y1931H probably damaging Het
Cnga1 T A 5: 72,618,231 E49V probably damaging Het
Col3a1 A G 1: 45,347,179 N160D possibly damaging Het
Crem C A 18: 3,268,070 R267L probably damaging Het
Ddx52 T C 11: 83,953,319 probably null Het
Ddx6 T C 9: 44,623,629 I127T probably damaging Het
Dopey2 T A 16: 93,809,416 Y2094N probably damaging Het
Dst C A 1: 34,163,135 N181K probably damaging Het
Dusp7 A G 9: 106,369,284 K163E possibly damaging Het
Dynlt1a T A 17: 6,311,739 T55S probably benign Het
Enpp2 T C 15: 54,870,211 N451S probably benign Het
Faap100 C A 11: 120,378,764 probably null Het
Fam208b G A 13: 3,576,540 Q455* probably null Het
Fam53a T C 5: 33,607,918 N148S probably damaging Het
Fat2 T C 11: 55,283,800 D2029G probably damaging Het
Flcn A T 11: 59,794,172 N484K possibly damaging Het
Gbp10 T A 5: 105,236,084 E17D probably benign Het
Gm14226 T C 2: 155,025,083 V320A possibly damaging Het
Gna13 T C 11: 109,395,939 I196T probably damaging Het
Gorasp1 G T 9: 119,927,995 P374T possibly damaging Het
Hc T C 2: 34,991,224 D1461G probably benign Het
Hmcn1 T C 1: 150,697,566 N2111D probably damaging Het
Hsdl2 A G 4: 59,612,696 T296A probably damaging Het
Impg2 A G 16: 56,205,149 D48G probably damaging Het
Kbtbd12 A T 6: 88,614,080 N383K probably benign Het
Kcnj12 T G 11: 61,069,571 F232V probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Ldhb T C 6: 142,490,465 D326G probably benign Het
Lrrc49 A G 9: 60,598,149 L607S probably damaging Het
Ltn1 A G 16: 87,420,186 S388P probably damaging Het
Mansc4 A G 6: 147,075,147 S324P probably benign Het
Meltf G A 16: 31,888,899 W368* probably null Het
Nacad A G 11: 6,602,255 L312P probably damaging Het
Ndc1 G T 4: 107,368,107 G7W probably benign Het
Nmral1 T A 16: 4,714,432 K172* probably null Het
Nol9 G T 4: 152,039,449 R32L probably damaging Het
Nsun5 A G 5: 135,375,058 Y296C probably damaging Het
Olfr1301 C T 2: 111,754,984 T245I probably benign Het
Oscp1 A G 4: 126,076,778 D120G possibly damaging Het
Parp14 C T 16: 35,860,441 C274Y probably benign Het
Pced1b T A 15: 97,384,798 H239Q possibly damaging Het
Pgap1 T C 1: 54,481,889 I865V probably benign Het
Ppp6r3 T A 19: 3,493,936 S360C probably damaging Het
Prb1 A G 6: 132,207,504 S389P unknown Het
Prr16 T G 18: 51,303,155 S235R probably benign Het
Rab11fip1 T C 8: 27,156,499 N183S probably benign Het
Rcn1 A G 2: 105,388,975 probably null Het
Rimkla C A 4: 119,468,091 A374S probably benign Het
Skint8 A T 4: 111,928,738 D127V probably damaging Het
Slc12a6 A G 2: 112,352,451 K724E probably damaging Het
Slc13a3 T C 2: 165,406,747 N537S unknown Het
Slc26a5 T C 5: 21,820,350 D457G possibly damaging Het
Slx4ip T C 2: 137,000,218 V21A possibly damaging Het
Stt3b A G 9: 115,258,558 Y291H probably damaging Het
Syn3 G A 10: 86,467,052 P80S probably damaging Het
Tiam1 A T 16: 89,858,597 probably null Het
Tjp1 T C 7: 65,343,651 D58G probably damaging Het
Tmprss15 T A 16: 79,003,378 I621F probably damaging Het
Tns1 C T 1: 73,953,470 S683N probably damaging Het
Ttn A G 2: 76,943,092 L2322P probably damaging Het
Ugdh G T 5: 65,417,059 H409N probably damaging Het
Vmn2r81 T A 10: 79,293,726 M817K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zbtb34 A G 2: 33,412,133 V132A probably damaging Het
Zfp119b A G 17: 55,939,992 C33R possibly damaging Het
Other mutations in Hs3st3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0723:Hs3st3b1 UTSW 11 63921575 missense probably benign
R1940:Hs3st3b1 UTSW 11 63889743 missense probably benign 0.01
R2386:Hs3st3b1 UTSW 11 63889213 nonsense probably null
R4784:Hs3st3b1 UTSW 11 63889260 missense probably benign 0.21
R5771:Hs3st3b1 UTSW 11 63889272 missense probably benign 0.00
R6102:Hs3st3b1 UTSW 11 63921855 nonsense probably null
R6153:Hs3st3b1 UTSW 11 63889498 missense probably damaging 0.98
R6191:Hs3st3b1 UTSW 11 63889203 missense probably benign 0.00
R7282:Hs3st3b1 UTSW 11 63921571 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACCAGGCAAGACCCTTGTG -3'
(R):5'- CTTTGCATCTGGCTGTACATG -3'

Sequencing Primer
(F):5'- GCAGGAACTCCAGCAATGC -3'
(R):5'- ACATGTTTTTGTACTCGTGCGC -3'
Posted On2018-06-06