Incidental Mutation 'R6552:Epb41l4a'
ID521752
Institutional Source Beutler Lab
Gene Symbol Epb41l4a
Ensembl Gene ENSMUSG00000024376
Gene Nameerythrocyte membrane protein band 4.1 like 4a
SynonymsNBL4, Epb4.1l4a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6552 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location33796327-34007206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33878979 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 163 (Y163H)
Ref Sequence ENSEMBL: ENSMUSP00000025234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025234]
Predicted Effect probably damaging
Transcript: ENSMUST00000025234
AA Change: Y163H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025234
Gene: ENSMUSG00000024376
AA Change: Y163H

DomainStartEndE-ValueType
B41 7 211 3.32e-78 SMART
FERM_C 215 303 1.48e-28 SMART
FA 310 357 2.25e-10 SMART
low complexity region 468 494 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 589 606 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the band 4.1 protein superfamily. Members of this superfamily are thought to play an important role in regulating interactions between the cytoskeleton and plasma membrane, and contain an amino terminal conserved domain that binds glycophorin C. This gene product is thought to be involved in the beta-catenin signaling pathway. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang5 A T 14: 43,962,797 H106L probably benign Het
Arsk A G 13: 76,072,196 Y260H probably damaging Het
Atxn2l C T 7: 126,493,821 V833M possibly damaging Het
Bpifa6 G A 2: 153,987,158 D202N probably damaging Het
Ccdc103 A G 11: 102,884,144 S190G probably benign Het
Col6a6 C T 9: 105,698,913 V2083I probably damaging Het
Creb5 A G 6: 53,685,384 D222G probably damaging Het
Cyp7a1 C T 4: 6,272,361 W284* probably null Het
Dnmt3a T C 12: 3,907,623 V868A probably damaging Het
Efr3a A G 15: 65,857,490 D680G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gabra1 A T 11: 42,147,099 S231T probably damaging Het
Golga4 T A 9: 118,514,231 F42I probably damaging Het
Greb1l G A 18: 10,541,814 S1187N probably benign Het
Haspin A G 11: 73,137,564 V233A probably benign Het
Il34 T A 8: 110,742,427 K187I probably benign Het
Kcnn2 A G 18: 45,560,098 H247R probably benign Het
Klf5 T C 14: 99,301,642 S84P probably benign Het
Lama5 G T 2: 180,181,154 P2773Q probably damaging Het
Lcat T C 8: 105,939,679 M404V possibly damaging Het
Lrp6 A T 6: 134,454,729 S1473T probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mn1 T C 5: 111,420,887 S908P possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Olfr695 TGAAGCC T 7: 106,714,643 probably benign Het
Pcdhb2 A T 18: 37,295,993 M340L probably benign Het
Pex1 G A 5: 3,623,953 E748K probably damaging Het
Qrich1 T C 9: 108,534,305 V343A possibly damaging Het
Rho A G 6: 115,931,748 probably null Het
Sdhaf4 C A 1: 24,005,606 probably benign Het
Sec24d A G 3: 123,290,552 I127V probably benign Het
Siae T C 9: 37,646,400 V501A possibly damaging Het
Skint3 T C 4: 112,290,285 Y402H possibly damaging Het
Skint6 A C 4: 113,067,490 V515G possibly damaging Het
Slc23a1 C A 18: 35,622,338 G475C probably damaging Het
Smad9 A G 3: 54,782,746 Y129C probably damaging Het
Snw1 A G 12: 87,459,419 probably null Het
Spice1 A G 16: 44,379,033 D616G possibly damaging Het
Stam2 T C 2: 52,708,227 probably null Het
Sumo3 G T 10: 77,606,257 probably benign Het
Syne2 T G 12: 75,890,241 N204K possibly damaging Het
Tmem200a T C 10: 25,993,483 N296S probably damaging Het
Ttbk1 G T 17: 46,478,962 T125N probably benign Het
Ubr2 G T 17: 46,966,268 probably null Het
Vmn1r80 C T 7: 12,193,757 L265F probably damaging Het
Vwa8 A T 14: 79,198,222 T1791S possibly damaging Het
Other mutations in Epb41l4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Epb41l4a APN 18 33801625 missense possibly damaging 0.95
IGL02942:Epb41l4a APN 18 33874201 missense probably damaging 1.00
IGL03051:Epb41l4a APN 18 33874772 missense probably damaging 1.00
IGL03236:Epb41l4a APN 18 33810219 missense probably damaging 0.98
PIT1430001:Epb41l4a UTSW 18 33797347 missense probably damaging 1.00
R0147:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0148:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0437:Epb41l4a UTSW 18 33880273 missense probably damaging 1.00
R1511:Epb41l4a UTSW 18 33832664 missense probably benign 0.01
R1666:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1668:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1750:Epb41l4a UTSW 18 33828208 nonsense probably null
R2022:Epb41l4a UTSW 18 33921840 missense probably benign 0.00
R2047:Epb41l4a UTSW 18 33828206 missense probably benign 0.00
R2133:Epb41l4a UTSW 18 33874195 missense probably damaging 1.00
R3741:Epb41l4a UTSW 18 33828102 critical splice donor site probably null
R4393:Epb41l4a UTSW 18 33891420 splice site probably null
R4700:Epb41l4a UTSW 18 33802507 splice site probably null
R4878:Epb41l4a UTSW 18 33798572 missense probably damaging 1.00
R5226:Epb41l4a UTSW 18 33810313 missense probably damaging 1.00
R5284:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R5584:Epb41l4a UTSW 18 33854271 missense probably damaging 1.00
R5945:Epb41l4a UTSW 18 33828730 missense possibly damaging 0.89
R6005:Epb41l4a UTSW 18 33828143 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6177:Epb41l4a UTSW 18 33798815 splice site probably null
R6188:Epb41l4a UTSW 18 33832665 missense probably benign
R6314:Epb41l4a UTSW 18 33874155 missense probably damaging 1.00
R7605:Epb41l4a UTSW 18 33797451 missense probably damaging 0.99
R7665:Epb41l4a UTSW 18 34006016 missense possibly damaging 0.92
R7727:Epb41l4a UTSW 18 33854273 missense probably damaging 1.00
R7729:Epb41l4a UTSW 18 33854273 missense probably damaging 1.00
R7802:Epb41l4a UTSW 18 33828174 missense probably benign 0.19
R7857:Epb41l4a UTSW 18 34006045 nonsense probably null
R8281:Epb41l4a UTSW 18 33878945 missense probably damaging 1.00
X0028:Epb41l4a UTSW 18 33802537 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TAGATAGCTGGGGTTTTCAATGAGC -3'
(R):5'- AGCCTGTGGGAATGCAAAAC -3'

Sequencing Primer
(F):5'- CTGGGGTTTTCAATGAGCATTTATTG -3'
(R):5'- GGGAATGCAAAACCACTTTATTTTC -3'
Posted On2018-06-06