Incidental Mutation 'R6553:Dis3l2'
ID 521760
Institutional Source Beutler Lab
Gene Symbol Dis3l2
Ensembl Gene ENSMUSG00000053333
Gene Name DIS3 like 3'-5' exoribonuclease 2
Synonyms 8030493P09Rik, 4930429A22Rik
MMRRC Submission 044678-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.319) question?
Stock # R6553 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 86631530-86977817 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86673216 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 69 (I69N)
Ref Sequence ENSEMBL: ENSMUSP00000139579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]
AlphaFold Q8CI75
Predicted Effect probably damaging
Transcript: ENSMUST00000065694
AA Change: I69N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: I69N

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 369 719 8.9e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168237
AA Change: I69N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: I69N

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 383 733 8.9e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189044
Predicted Effect probably damaging
Transcript: ENSMUST00000190618
AA Change: I69N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333
AA Change: I69N

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
PDB:2VNU|D 50 123 4e-10 PDB
Meta Mutation Damage Score 0.9088 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,639,250 (GRCm39) D598E probably benign Het
Ascc3 A G 10: 50,718,273 (GRCm39) K1989E probably benign Het
Asic5 A T 3: 81,916,773 (GRCm39) T288S possibly damaging Het
Chd1 A G 17: 15,945,692 (GRCm39) N72S probably benign Het
Ciita T A 16: 10,329,609 (GRCm39) V628E probably benign Het
Cyp2c50 A G 19: 40,079,046 (GRCm39) T130A probably benign Het
Dapk1 T A 13: 60,908,975 (GRCm39) V1196E probably damaging Het
Exph5 A G 9: 53,213,012 (GRCm39) probably benign Het
Fcgbp A T 7: 27,813,404 (GRCm39) Q2313L possibly damaging Het
Gm2888 A G 14: 3,037,722 (GRCm38) H238R possibly damaging Het
Gm5622 A G 14: 51,895,200 (GRCm39) K120E probably damaging Het
Gpr155 A T 2: 73,179,989 (GRCm39) I157N probably damaging Het
Hltf T C 3: 20,126,558 (GRCm39) V245A probably damaging Het
Kmt2e G A 5: 23,668,024 (GRCm39) V28I probably damaging Het
Lsm3 GATATATA GATATATATA 6: 91,496,617 (GRCm39) probably null Het
Nprl3 C T 11: 32,184,812 (GRCm39) R399Q probably benign Het
Or6c6c C T 10: 129,540,932 (GRCm39) R62C probably benign Het
Ptgs2 T C 1: 149,979,738 (GRCm39) V281A possibly damaging Het
Speer4f2 A G 5: 17,579,420 (GRCm39) E73G probably damaging Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Trav13n-3 A G 14: 53,574,618 (GRCm39) T14A probably benign Het
Trav9d-4 A T 14: 53,221,198 (GRCm39) Q63L probably benign Het
Vmn2r75 T A 7: 85,813,453 (GRCm39) N450Y probably benign Het
Vmn2r97 G A 17: 19,150,566 (GRCm39) W471* probably null Het
Zfp27 G A 7: 29,595,818 (GRCm39) T49I possibly damaging Het
Zpld2 A G 4: 133,929,367 (GRCm39) S313P probably damaging Het
Other mutations in Dis3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Dis3l2 APN 1 86,784,925 (GRCm39) missense probably benign 0.00
IGL01607:Dis3l2 APN 1 86,673,209 (GRCm39) missense probably benign 0.04
IGL02233:Dis3l2 APN 1 86,917,953 (GRCm39) missense probably damaging 1.00
IGL02698:Dis3l2 APN 1 86,976,551 (GRCm39) splice site probably benign
R0514:Dis3l2 UTSW 1 86,974,814 (GRCm39) missense probably damaging 1.00
R0893:Dis3l2 UTSW 1 86,971,928 (GRCm39) splice site probably null
R1086:Dis3l2 UTSW 1 86,917,871 (GRCm39) missense probably benign 0.36
R1140:Dis3l2 UTSW 1 86,749,160 (GRCm39) missense probably benign 0.00
R1509:Dis3l2 UTSW 1 86,948,808 (GRCm39) missense possibly damaging 0.91
R2029:Dis3l2 UTSW 1 86,782,189 (GRCm39) splice site probably benign
R2511:Dis3l2 UTSW 1 86,917,980 (GRCm39) missense probably benign 0.05
R3772:Dis3l2 UTSW 1 86,782,130 (GRCm39) missense probably benign
R4163:Dis3l2 UTSW 1 86,748,959 (GRCm39) missense probably benign 0.00
R4547:Dis3l2 UTSW 1 86,977,393 (GRCm39) missense probably benign 0.00
R4548:Dis3l2 UTSW 1 86,977,393 (GRCm39) missense probably benign 0.00
R4650:Dis3l2 UTSW 1 86,918,043 (GRCm39) missense possibly damaging 0.83
R4810:Dis3l2 UTSW 1 86,975,296 (GRCm39) missense probably damaging 0.99
R4936:Dis3l2 UTSW 1 86,971,890 (GRCm39) missense probably benign 0.00
R5010:Dis3l2 UTSW 1 86,688,043 (GRCm39) missense probably benign 0.21
R5040:Dis3l2 UTSW 1 86,785,059 (GRCm39) missense probably damaging 0.98
R5272:Dis3l2 UTSW 1 86,901,126 (GRCm39) missense possibly damaging 0.72
R5500:Dis3l2 UTSW 1 86,948,841 (GRCm39) critical splice donor site probably null
R5556:Dis3l2 UTSW 1 86,901,126 (GRCm39) missense possibly damaging 0.72
R5772:Dis3l2 UTSW 1 86,806,154 (GRCm39) missense probably damaging 1.00
R5808:Dis3l2 UTSW 1 86,977,360 (GRCm39) missense possibly damaging 0.94
R5950:Dis3l2 UTSW 1 86,948,830 (GRCm39) missense probably damaging 0.96
R6328:Dis3l2 UTSW 1 86,782,153 (GRCm39) missense probably benign 0.05
R6585:Dis3l2 UTSW 1 86,673,216 (GRCm39) missense probably damaging 1.00
R6905:Dis3l2 UTSW 1 86,972,561 (GRCm39) missense probably benign 0.00
R6921:Dis3l2 UTSW 1 86,785,063 (GRCm39) missense probably benign
R7162:Dis3l2 UTSW 1 86,971,752 (GRCm39) missense possibly damaging 0.94
R7270:Dis3l2 UTSW 1 86,918,025 (GRCm39) missense possibly damaging 0.49
R7438:Dis3l2 UTSW 1 86,673,222 (GRCm39) critical splice donor site probably null
R8422:Dis3l2 UTSW 1 86,782,099 (GRCm39) missense probably benign
R8696:Dis3l2 UTSW 1 86,719,162 (GRCm39) nonsense probably null
R9235:Dis3l2 UTSW 1 86,749,061 (GRCm39) missense possibly damaging 0.95
R9291:Dis3l2 UTSW 1 86,901,215 (GRCm39) missense possibly damaging 0.82
R9629:Dis3l2 UTSW 1 86,974,784 (GRCm39) missense probably benign 0.00
X0027:Dis3l2 UTSW 1 86,688,073 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATTGCTGCCTCATGTTTCTAGG -3'
(R):5'- CTAGGCAACATTGACATGAGC -3'

Sequencing Primer
(F):5'- GCCTCATGTTTCTAGGTGTGTCC -3'
(R):5'- CATTGACATGAGCTACAAAGGC -3'
Posted On 2018-06-06