Mutagenetix > Incidental Mutations

Incidental Mutation 'R6553:Dis3l2'

521760

Institutional Source

Beutler Lab

Gene Symbol

Dis3l2

Ensembl Gene

ENSMUSG00000053333

Gene Name

DIS3 like 3'-5' exoribonuclease 2

Synonyms

4930429A22Rik, 8030493P09Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.387) question?

Stock #

R6553 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86703808-87050095 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 86745494 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 69 (I69N)

Ref Sequence

ENSEMBL: ENSMUSP00000139579 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]

Predicted Effect

probably damaging
Transcript: ENSMUST00000065694
AA Change: I69N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: I69N

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	369	719	8.9e-140	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168237
AA Change: I69N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: I69N

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	383	733	8.9e-140	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188121

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189044

Predicted Effect

probably damaging
Transcript: ENSMUST00000190618
AA Change: I69N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333
AA Change: I69N

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
PDB:2VNU\|D	50	123	4e-10	PDB

Meta Mutation Damage Score

0.9088

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam1b	G	T	5: 121,501,187	D598E	probably benign	Het
Ascc3	A	G	10: 50,842,177	K1989E	probably benign	Het
Asic5	A	T	3: 82,009,466	T288S	possibly damaging	Het
Chd1	A	G	17: 15,725,430	N72S	probably benign	Het
Ciita	T	A	16: 10,511,745	V628E	probably benign	Het
Cyp2c50	A	G	19: 40,090,602	T130A	probably benign	Het
Dapk1	T	A	13: 60,761,161	V1196E	probably damaging	Het
Exph5	A	G	9: 53,301,712		probably benign	Het
Fcgbp	A	T	7: 28,113,979	Q2313L	possibly damaging	Het
Gm2888	A	G	14: 3,037,722	H238R	possibly damaging	Het
Gm5622	A	G	14: 51,657,743	K120E	probably damaging	Het
Gm7534	A	G	4: 134,202,056	S313P	probably damaging	Het
Gpr155	A	T	2: 73,349,645	I157N	probably damaging	Het
Hltf	T	C	3: 20,072,394	V245A	probably damaging	Het
Kmt2e	G	A	5: 23,463,026	V28I	probably damaging	Het
Lsm3	GATATATA	GATATATATA	6: 91,519,635		probably null	Het
Nprl3	C	T	11: 32,234,812	R399Q	probably benign	Het
Olfr804	C	T	10: 129,705,063	R62C	probably benign	Het
Ptgs2	T	C	1: 150,103,987	V281A	possibly damaging	Het
Speer4f2	A	G	5: 17,374,422	E73G	probably damaging	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Trav13n-3	A	G	14: 53,337,161	T14A	probably benign	Het
Trav9d-4	A	T	14: 52,983,741	Q63L	probably benign	Het
Vmn2r75	T	A	7: 86,164,245	N450Y	probably benign	Het
Vmn2r97	G	A	17: 18,930,304	W471*	probably null	Het
Zfp27	G	A	7: 29,896,393	T49I	possibly damaging	Het

Other mutations in Dis3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Dis3l2	APN	1	86857203	missense	probably benign	0.00
IGL01607:Dis3l2	APN	1	86745487	missense	probably benign	0.04
IGL02233:Dis3l2	APN	1	86990231	missense	probably damaging	1.00
IGL02698:Dis3l2	APN	1	87048829	splice site	probably benign
R0514:Dis3l2	UTSW	1	87047092	missense	probably damaging	1.00
R0893:Dis3l2	UTSW	1	87044206	splice site	probably null
R1086:Dis3l2	UTSW	1	86990149	missense	probably benign	0.36
R1140:Dis3l2	UTSW	1	86821438	missense	probably benign	0.00
R1509:Dis3l2	UTSW	1	87021086	missense	possibly damaging	0.91
R2029:Dis3l2	UTSW	1	86854467	splice site	probably benign
R2511:Dis3l2	UTSW	1	86990258	missense	probably benign	0.05
R3772:Dis3l2	UTSW	1	86854408	missense	probably benign
R4163:Dis3l2	UTSW	1	86821237	missense	probably benign	0.00
R4547:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4548:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4650:Dis3l2	UTSW	1	86990321	missense	possibly damaging	0.83
R4810:Dis3l2	UTSW	1	87047574	missense	probably damaging	0.99
R4936:Dis3l2	UTSW	1	87044168	missense	probably benign	0.00
R5010:Dis3l2	UTSW	1	86760321	missense	probably benign	0.21
R5040:Dis3l2	UTSW	1	86857337	missense	probably damaging	0.98
R5272:Dis3l2	UTSW	1	86973404	missense	possibly damaging	0.72
R5500:Dis3l2	UTSW	1	87021119	critical splice donor site	probably null
R5556:Dis3l2	UTSW	1	86973404	missense	possibly damaging	0.72
R5772:Dis3l2	UTSW	1	86878432	missense	probably damaging	1.00
R5808:Dis3l2	UTSW	1	87049638	missense	possibly damaging	0.94
R5950:Dis3l2	UTSW	1	87021108	missense	probably damaging	0.96
R6328:Dis3l2	UTSW	1	86854431	missense	probably benign	0.05
R6585:Dis3l2	UTSW	1	86745494	missense	probably damaging	1.00
R6905:Dis3l2	UTSW	1	87044839	missense	probably benign	0.00
R6921:Dis3l2	UTSW	1	86857341	missense	probably benign
R7162:Dis3l2	UTSW	1	87044030	missense	possibly damaging	0.94
R7270:Dis3l2	UTSW	1	86990303	missense	possibly damaging	0.49
R7438:Dis3l2	UTSW	1	86745500	critical splice donor site	probably null
R8422:Dis3l2	UTSW	1	86854377	missense	probably benign
R8696:Dis3l2	UTSW	1	86791440	nonsense	probably null
X0027:Dis3l2	UTSW	1	86760351	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- ATTGCTGCCTCATGTTTCTAGG -3'
(R):5'- CTAGGCAACATTGACATGAGC -3'

Sequencing Primer
(F):5'- GCCTCATGTTTCTAGGTGTGTCC -3'
(R):5'- CATTGACATGAGCTACAAAGGC -3'

Posted On

2018-06-06