Incidental Mutation 'R6553:Speer4f2'
ID 521772
Institutional Source Beutler Lab
Gene Symbol Speer4f2
Ensembl Gene ENSMUSG00000091827
Gene Name spermatogenesis associated glutamate (E)-rich protein 4f2
Synonyms Gm3535, Gm3495
MMRRC Submission 044678-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.178) question?
Stock # R6553 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 17373180-17378028 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17374422 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 73 (E73G)
Ref Sequence ENSEMBL: ENSMUSP00000129818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166086]
AlphaFold E9Q366
Predicted Effect probably damaging
Transcript: ENSMUST00000166086
AA Change: E73G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129818
Gene: ENSMUSG00000091827
AA Change: E73G

DomainStartEndE-ValueType
Pfam:Takusan 34 112 9.6e-20 PFAM
low complexity region 208 253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,501,187 D598E probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Asic5 A T 3: 82,009,466 T288S possibly damaging Het
Chd1 A G 17: 15,725,430 N72S probably benign Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Cyp2c50 A G 19: 40,090,602 T130A probably benign Het
Dapk1 T A 13: 60,761,161 V1196E probably damaging Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Exph5 A G 9: 53,301,712 probably benign Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm2888 A G 14: 3,037,722 H238R possibly damaging Het
Gm5622 A G 14: 51,657,743 K120E probably damaging Het
Gm7534 A G 4: 134,202,056 S313P probably damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hltf T C 3: 20,072,394 V245A probably damaging Het
Kmt2e G A 5: 23,463,026 V28I probably damaging Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr804 C T 10: 129,705,063 R62C probably benign Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trav13n-3 A G 14: 53,337,161 T14A probably benign Het
Trav9d-4 A T 14: 52,983,741 Q63L probably benign Het
Vmn2r75 T A 7: 86,164,245 N450Y probably benign Het
Vmn2r97 G A 17: 18,930,304 W471* probably null Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Speer4f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Speer4f2 APN 5 17376567 missense possibly damaging 0.94
IGL02092:Speer4f2 APN 5 17376629 nonsense probably null
IGL03100:Speer4f2 APN 5 17376530 missense probably damaging 0.99
R0939:Speer4f2 UTSW 5 17374404 missense probably damaging 0.99
R1384:Speer4f2 UTSW 5 17374449 missense probably damaging 1.00
R1528:Speer4f2 UTSW 5 17376542 missense
R1873:Speer4f2 UTSW 5 17374449 missense probably damaging 1.00
R3608:Speer4f2 UTSW 5 17374494 missense probably benign 0.03
R4972:Speer4f2 UTSW 5 17374425 missense probably benign 0.27
R5421:Speer4f2 UTSW 5 17374358 missense possibly damaging 0.88
R5450:Speer4f2 UTSW 5 17373219 missense possibly damaging 0.85
R5452:Speer4f2 UTSW 5 17376500 missense possibly damaging 0.93
R5531:Speer4f2 UTSW 5 17376528 missense possibly damaging 0.57
R5924:Speer4f2 UTSW 5 17376624 missense probably damaging 1.00
R6454:Speer4f2 UTSW 5 17374433 missense probably damaging 0.99
R6585:Speer4f2 UTSW 5 17374422 missense probably damaging 1.00
R6649:Speer4f2 UTSW 5 17375769 missense probably benign 0.05
R6878:Speer4f2 UTSW 5 17375767 missense probably damaging 0.99
R7089:Speer4f2 UTSW 5 17376663 missense
R7129:Speer4f2 UTSW 5 17377448 missense
R7448:Speer4f2 UTSW 5 17376542 missense
R7654:Speer4f2 UTSW 5 17374415 missense
R7942:Speer4f2 UTSW 5 17377632 missense unknown
R8170:Speer4f2 UTSW 5 17374461 missense
R8409:Speer4f2 UTSW 5 17377421 missense
R9154:Speer4f2 UTSW 5 17376612 missense
Predicted Primers PCR Primer
(F):5'- GGTAGAACTGAGATCCACTGAG -3'
(R):5'- ATGGTATAGCTTCCCACAACCC -3'

Sequencing Primer
(F):5'- AATCTCATACTGGGACCAATCTCTTG -3'
(R):5'- CACCCCTTTAAAAGCATAAGATAAGG -3'
Posted On 2018-06-06