Incidental Mutation 'R6553:Lsm3'
ID 521778
Institutional Source Beutler Lab
Gene Symbol Lsm3
Ensembl Gene ENSMUSG00000034192
Gene Name LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated
Synonyms 2610005D18Rik, SMX4, USS2, 1010001J12Rik, 6030401D18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock # R6553 (G1)
Quality Score 217.468
Status Not validated
Chromosome 6
Chromosomal Location 91515928-91522625 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) GATATATA to GATATATATA at 91519635 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032182] [ENSMUST00000040607] [ENSMUST00000206476] [ENSMUST00000206947]
AlphaFold P62311
Predicted Effect probably benign
Transcript: ENSMUST00000032182
SMART Domains Protein: ENSMUSP00000032182
Gene: ENSMUSG00000030094

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 106 115 N/A INTRINSIC
low complexity region 118 142 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 371 387 N/A INTRINSIC
low complexity region 425 439 N/A INTRINSIC
Pfam:Rad4 485 619 6.4e-26 PFAM
BHD_1 623 675 4.09e-25 SMART
BHD_2 677 737 4.96e-24 SMART
BHD_3 744 818 4.83e-45 SMART
low complexity region 826 835 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040607
SMART Domains Protein: ENSMUSP00000044178
Gene: ENSMUSG00000034192

DomainStartEndE-ValueType
Sm 19 97 3.79e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126253
Predicted Effect probably benign
Transcript: ENSMUST00000150279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205609
Predicted Effect probably benign
Transcript: ENSMUST00000206476
Predicted Effect probably null
Transcript: ENSMUST00000206947
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,501,187 D598E probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Asic5 A T 3: 82,009,466 T288S possibly damaging Het
Chd1 A G 17: 15,725,430 N72S probably benign Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Cyp2c50 A G 19: 40,090,602 T130A probably benign Het
Dapk1 T A 13: 60,761,161 V1196E probably damaging Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Exph5 A G 9: 53,301,712 probably benign Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm2888 A G 14: 3,037,722 H238R possibly damaging Het
Gm5622 A G 14: 51,657,743 K120E probably damaging Het
Gm7534 A G 4: 134,202,056 S313P probably damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hltf T C 3: 20,072,394 V245A probably damaging Het
Kmt2e G A 5: 23,463,026 V28I probably damaging Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr804 C T 10: 129,705,063 R62C probably benign Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trav13n-3 A G 14: 53,337,161 T14A probably benign Het
Trav9d-4 A T 14: 52,983,741 Q63L probably benign Het
Vmn2r75 T A 7: 86,164,245 N450Y probably benign Het
Vmn2r97 G A 17: 18,930,304 W471* probably null Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in Lsm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Lsm3 APN 6 91516088 splice site probably benign
R2172:Lsm3 UTSW 6 91522272 missense possibly damaging 0.51
R6552:Lsm3 UTSW 6 91519635 frame shift probably null
R6555:Lsm3 UTSW 6 91519635 frame shift probably null
R6588:Lsm3 UTSW 6 91519635 frame shift probably null
R6689:Lsm3 UTSW 6 91519635 frame shift probably null
R8022:Lsm3 UTSW 6 91519561 missense probably benign 0.10
R8859:Lsm3 UTSW 6 91522270 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGGTGTAAGTATTGAACCTGTTAC -3'
(R):5'- ACATGACACATTCGTAGAGACC -3'

Sequencing Primer
(F):5'- TGAACCTGTTACTTAAAATCCACTTG -3'
(R):5'- AGGGCACTGTCAAACTCTTG -3'
Posted On 2018-06-06