Incidental Mutation 'R6526:Aamp'
ID521784
Institutional Source Beutler Lab
Gene Symbol Aamp
Ensembl Gene ENSMUSG00000006299
Gene Nameangio-associated migratory protein
SynonymsAamp-rs
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6526 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74279840-74284738 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 74284172 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006462] [ENSMUST00000016309] [ENSMUST00000027370] [ENSMUST00000077985] [ENSMUST00000087226] [ENSMUST00000113796] [ENSMUST00000113805] [ENSMUST00000190008] [ENSMUST00000178235] [ENSMUST00000187046]
Predicted Effect probably benign
Transcript: ENSMUST00000006462
SMART Domains Protein: ENSMUSP00000006462
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 34 42 N/A INTRINSIC
low complexity region 46 64 N/A INTRINSIC
WD40 81 121 2.76e-2 SMART
WD40 124 163 4.83e-7 SMART
WD40 166 203 7.96e0 SMART
WD40 205 244 2.51e-5 SMART
WD40 247 289 2.38e-6 SMART
WD40 292 346 2.47e1 SMART
WD40 349 387 2.61e-3 SMART
WD40 390 429 1.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000016309
SMART Domains Protein: ENSMUSP00000016309
Gene: ENSMUSG00000006301

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
Pfam:Bax1-I 94 305 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000027370
SMART Domains Protein: ENSMUSP00000027370
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
Blast:Lactamase_B 4 79 1e-24 BLAST
Lactamase_B 129 291 1.05e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077985
SMART Domains Protein: ENSMUSP00000077135
Gene: ENSMUSG00000064272

DomainStartEndE-ValueType
Pfam:7tm_1 30 264 7.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087226
SMART Domains Protein: ENSMUSP00000084478
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
low complexity region 43 61 N/A INTRINSIC
Pfam:DUF4748 71 121 2.9e-23 PFAM
Lactamase_B 168 330 1.05e-31 SMART
Pfam:HAGH_C 331 421 6.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113796
SMART Domains Protein: ENSMUSP00000109427
Gene: ENSMUSG00000006301

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
Pfam:Bax1-I 94 305 4.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113805
SMART Domains Protein: ENSMUSP00000109436
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
Blast:Lactamase_B 4 79 4e-28 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152492
Predicted Effect probably null
Transcript: ENSMUST00000190008
SMART Domains Protein: ENSMUSP00000140427
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
low complexity region 40 58 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192088
Predicted Effect probably benign
Transcript: ENSMUST00000178235
SMART Domains Protein: ENSMUSP00000136644
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 47 65 N/A INTRINSIC
WD40 82 122 2.76e-2 SMART
WD40 125 164 4.83e-7 SMART
WD40 167 204 7.96e0 SMART
WD40 206 245 2.51e-5 SMART
WD40 248 290 2.38e-6 SMART
WD40 293 347 2.47e1 SMART
WD40 350 388 2.61e-3 SMART
WD40 391 430 1.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187046
SMART Domains Protein: ENSMUSP00000139411
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
WD40 20 60 1.7e-4 SMART
WD40 63 102 3e-9 SMART
WD40 120 160 1.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187908
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the immunoglobulin superfamily. The encoded protein is associated with angiogenesis, with potential roles in endothelial tube formation and the migration of endothelial cells. It may also regulate smooth muscle cell migration via the RhoA pathway. The encoded protein can bind to heparin and may mediate heparin-sensitive cell adhesion. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C T 11: 94,359,372 G975D probably benign Het
Abhd13 G A 8: 9,987,777 G125S probably damaging Het
Ache T A 5: 137,290,644 L204Q probably damaging Het
Acnat2 A G 4: 49,383,497 S19P probably benign Het
Adprh A G 16: 38,447,276 Y216H probably benign Het
Anapc1 T A 2: 128,672,135 K429* probably null Het
Anxa13 T C 15: 58,344,957 noncoding transcript Het
Aprt A C 8: 122,576,816 L6W probably damaging Het
Arhgef15 T C 11: 68,949,994 T569A probably damaging Het
Atp11a T C 8: 12,864,999 L1139P probably benign Het
Atp2b4 A G 1: 133,711,729 S1136P probably damaging Het
B9d1 T A 11: 61,509,097 Y90* probably null Het
Btla G A 16: 45,239,094 A54T probably damaging Het
Cd63 T C 10: 128,911,489 V35A probably benign Het
Chek2 T C 5: 110,848,690 F173L probably damaging Het
Cntnap3 T A 13: 64,781,888 N499I possibly damaging Het
Cog4 T C 8: 110,881,786 L738P probably damaging Het
Cops6 T C 5: 138,163,900 probably null Het
Cpeb1 T A 7: 81,361,669 I175F probably benign Het
Cyp3a16 C T 5: 145,455,895 D174N probably benign Het
Dnah6 T G 6: 73,074,704 I2984L probably benign Het
Dock10 A T 1: 80,586,351 I540N probably damaging Het
Elf5 A G 2: 103,439,233 Y53C probably damaging Het
Elmod2 T C 8: 83,319,457 T164A probably damaging Het
Epn3 A G 11: 94,494,932 probably null Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Gm11115 T A 5: 88,154,050 probably null Het
Gm13103 A G 4: 143,852,814 D323G probably damaging Het
Golga3 T A 5: 110,204,895 I884N probably damaging Het
Gria2 A T 3: 80,692,469 F703I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtpbp2 A T 17: 46,164,111 probably null Het
Herc2 T C 7: 56,157,330 S2419P probably damaging Het
Ikbkap T C 4: 56,798,812 probably null Het
Inpp5d T C 1: 87,676,250 probably benign Het
Kdm2b C A 5: 122,961,469 V136F probably damaging Het
Klra2 T A 6: 131,221,876 D234V probably benign Het
Lct A T 1: 128,300,478 S1093T probably benign Het
March9 A G 10: 127,056,689 L310P probably benign Het
Morc1 G T 16: 48,587,124 E668* probably null Het
Mum1 A G 10: 80,232,279 T86A probably benign Het
Nbas A T 12: 13,405,425 L1213F probably damaging Het
Neto1 A G 18: 86,498,748 T397A possibly damaging Het
Oit3 A G 10: 59,429,640 C268R probably damaging Het
Olfr476 A G 7: 107,967,462 T22A probably benign Het
Pcx T C 19: 4,604,495 F312L probably benign Het
Pitx2 T C 3: 129,214,783 probably null Het
Pkhd1l1 G A 15: 44,498,089 probably null Het
Polr1a C A 6: 71,929,443 D414E possibly damaging Het
Prkch T C 12: 73,702,775 Y381H probably damaging Het
Ptger3 T A 3: 157,567,502 V162E probably damaging Het
Ptgr2 T G 12: 84,313,952 M332R probably damaging Het
Ptprq G T 10: 107,542,653 S2009* probably null Het
Rangrf C T 11: 68,973,688 G11R probably damaging Het
Rbl2 A T 8: 91,096,839 Q465L probably benign Het
Rhbdd1 A T 1: 82,340,659 M88L probably benign Het
Setd2 G A 9: 110,532,717 M13I probably benign Het
Sirpb1a T C 3: 15,379,020 Y384C probably damaging Het
Slc13a1 C T 6: 24,097,612 G439S probably damaging Het
Slc41a1 T A 1: 131,841,149 I239N probably damaging Het
Slit2 T A 5: 48,304,167 C1502S probably damaging Het
Slit3 G A 11: 35,661,292 E888K probably benign Het
Srrm3 G T 5: 135,835,234 R62L probably damaging Het
Synm A G 7: 67,735,583 V777A possibly damaging Het
Trmt13 T A 3: 116,592,215 N31I probably damaging Het
Trpm8 G A 1: 88,361,998 E893K probably damaging Het
Uqcc1 A G 2: 155,851,423 F197S probably damaging Het
Vmn1r67 T A 7: 10,447,671 N287K probably benign Het
Vmn2r44 A T 7: 8,378,099 M265K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xdh C A 17: 73,900,551 C937F probably damaging Het
Zfp846 T A 9: 20,593,871 N342K probably benign Het
Other mutations in Aamp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Aamp APN 1 74281436 unclassified probably benign
IGL02476:Aamp APN 1 74281524 unclassified probably benign
R0960:Aamp UTSW 1 74281145 missense possibly damaging 0.77
R1590:Aamp UTSW 1 74283211 missense probably damaging 1.00
R2138:Aamp UTSW 1 74283963 missense probably benign 0.00
R4112:Aamp UTSW 1 74281227 unclassified probably benign
R4223:Aamp UTSW 1 74281126 missense probably damaging 0.98
R5049:Aamp UTSW 1 74282539 missense probably damaging 1.00
R5283:Aamp UTSW 1 74284006 missense possibly damaging 0.49
R6353:Aamp UTSW 1 74280828 missense probably benign 0.37
R6683:Aamp UTSW 1 74282445 missense possibly damaging 0.76
R6884:Aamp UTSW 1 74284248 unclassified probably benign
R7141:Aamp UTSW 1 74284111 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGGTGACCTCACTATCATCCG -3'
(R):5'- ACCTTTAGTTTCTAGGCCTGGC -3'

Sequencing Primer
(F):5'- TTCCTGGGGTTCCAAGACC -3'
(R):5'- CTAGGCCTGGCTGGGTG -3'
Posted On2018-06-06