Incidental Mutation 'R6553:Nprl3'
ID 521792
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Name nitrogen permease regulator-like 3
Synonyms Mare, HS-26, Prox1, Phg, -14 gene, HS-40, m(alpha)RE
MMRRC Submission 044678-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # R6553 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 32181963-32217707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32184812 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 399 (R399Q)
Ref Sequence ENSEMBL: ENSMUSP00000105016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020528] [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000136903] [ENSMUST00000137950] [ENSMUST00000141859] [ENSMUST00000142964] [ENSMUST00000138050]
AlphaFold Q8VIJ8
Predicted Effect probably benign
Transcript: ENSMUST00000020528
SMART Domains Protein: ENSMUSP00000020528
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:Pur_DNA_glyco 109 304 1.2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020530
AA Change: R424Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: R424Q

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109389
AA Change: R399Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: R399Q

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109390
Predicted Effect probably benign
Transcript: ENSMUST00000124640
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129573
Predicted Effect probably benign
Transcript: ENSMUST00000136903
Predicted Effect probably benign
Transcript: ENSMUST00000137950
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141859
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142964
SMART Domains Protein: ENSMUSP00000118208
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
SCOP:d1ewna_ 102 125 5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146890
Predicted Effect probably benign
Transcript: ENSMUST00000138050
SMART Domains Protein: ENSMUSP00000121960
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
SCOP:d1ewna_ 102 125 5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148636
Meta Mutation Damage Score 0.0735 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b G T 5: 121,639,250 (GRCm39) D598E probably benign Het
Ascc3 A G 10: 50,718,273 (GRCm39) K1989E probably benign Het
Asic5 A T 3: 81,916,773 (GRCm39) T288S possibly damaging Het
Chd1 A G 17: 15,945,692 (GRCm39) N72S probably benign Het
Ciita T A 16: 10,329,609 (GRCm39) V628E probably benign Het
Cyp2c50 A G 19: 40,079,046 (GRCm39) T130A probably benign Het
Dapk1 T A 13: 60,908,975 (GRCm39) V1196E probably damaging Het
Dis3l2 T A 1: 86,673,216 (GRCm39) I69N probably damaging Het
Exph5 A G 9: 53,213,012 (GRCm39) probably benign Het
Fcgbp A T 7: 27,813,404 (GRCm39) Q2313L possibly damaging Het
Gm2888 A G 14: 3,037,722 (GRCm38) H238R possibly damaging Het
Gm5622 A G 14: 51,895,200 (GRCm39) K120E probably damaging Het
Gpr155 A T 2: 73,179,989 (GRCm39) I157N probably damaging Het
Hltf T C 3: 20,126,558 (GRCm39) V245A probably damaging Het
Kmt2e G A 5: 23,668,024 (GRCm39) V28I probably damaging Het
Lsm3 GATATATA GATATATATA 6: 91,496,617 (GRCm39) probably null Het
Or6c6c C T 10: 129,540,932 (GRCm39) R62C probably benign Het
Ptgs2 T C 1: 149,979,738 (GRCm39) V281A possibly damaging Het
Speer4f2 A G 5: 17,579,420 (GRCm39) E73G probably damaging Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Trav13n-3 A G 14: 53,574,618 (GRCm39) T14A probably benign Het
Trav9d-4 A T 14: 53,221,198 (GRCm39) Q63L probably benign Het
Vmn2r75 T A 7: 85,813,453 (GRCm39) N450Y probably benign Het
Vmn2r97 G A 17: 19,150,566 (GRCm39) W471* probably null Het
Zfp27 G A 7: 29,595,818 (GRCm39) T49I possibly damaging Het
Zpld2 A G 4: 133,929,367 (GRCm39) S313P probably damaging Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32,217,539 (GRCm39) start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32,198,230 (GRCm39) intron probably benign
IGL03366:Nprl3 APN 11 32,200,256 (GRCm39) missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32,189,784 (GRCm39) unclassified probably benign
R0555:Nprl3 UTSW 11 32,183,118 (GRCm39) critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32,184,876 (GRCm39) missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32,182,973 (GRCm39) missense probably damaging 0.97
R2172:Nprl3 UTSW 11 32,184,894 (GRCm39) missense probably benign 0.00
R2884:Nprl3 UTSW 11 32,198,163 (GRCm39) missense probably damaging 1.00
R3713:Nprl3 UTSW 11 32,205,464 (GRCm39) missense probably damaging 0.98
R3836:Nprl3 UTSW 11 32,183,082 (GRCm39) missense probably damaging 1.00
R4354:Nprl3 UTSW 11 32,184,906 (GRCm39) missense probably benign 0.00
R6052:Nprl3 UTSW 11 32,205,453 (GRCm39) missense possibly damaging 0.92
R6056:Nprl3 UTSW 11 32,217,432 (GRCm39) missense probably damaging 0.98
R6307:Nprl3 UTSW 11 32,189,828 (GRCm39) missense probably damaging 1.00
R6585:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6774:Nprl3 UTSW 11 32,187,381 (GRCm39) missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32,217,509 (GRCm39) missense probably damaging 0.99
R7746:Nprl3 UTSW 11 32,198,150 (GRCm39) nonsense probably null
R7980:Nprl3 UTSW 11 32,187,357 (GRCm39) missense probably damaging 1.00
R8483:Nprl3 UTSW 11 32,213,083 (GRCm39) missense probably damaging 1.00
R8712:Nprl3 UTSW 11 32,187,334 (GRCm39) missense possibly damaging 0.84
R8827:Nprl3 UTSW 11 32,184,742 (GRCm39) missense probably benign 0.00
R9264:Nprl3 UTSW 11 32,183,948 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCTTATTCCAACAGTACCCAGG -3'
(R):5'- TAGGTACTGGGGCTGCTAAG -3'

Sequencing Primer
(F):5'- AACAGTACCCAGGCTTCTTGGATG -3'
(R):5'- TCCCCAGGAATAGGAATCTGTTC -3'
Posted On 2018-06-06